Incidental Mutation 'R5174:Celf1'
ID470564
Institutional Source Beutler Lab
Gene Symbol Celf1
Ensembl Gene ENSMUSG00000005506
Gene NameCUGBP, Elav-like family member 1
SynonymsCUG-BP, D2Wsu101e, 1600010O03Rik, Brunol2, Cugbp1, CUG-BP1
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R5174 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90940382-91019497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91001008 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 61 (C61R)
Ref Sequence ENSEMBL: ENSMUSP00000064323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005643] [ENSMUST00000068726] [ENSMUST00000068747] [ENSMUST00000111448] [ENSMUST00000111449] [ENSMUST00000111451] [ENSMUST00000111452] [ENSMUST00000111455] [ENSMUST00000177642]
Predicted Effect probably damaging
Transcript: ENSMUST00000005643
AA Change: C88R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005643
Gene: ENSMUSG00000005506
AA Change: C88R

DomainStartEndE-ValueType
RRM 44 122 5.93e-17 SMART
RRM 136 211 2.52e-20 SMART
low complexity region 226 234 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
low complexity region 283 303 N/A INTRINSIC
low complexity region 311 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
RRM 429 502 1.71e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068726
AA Change: C61R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064323
Gene: ENSMUSG00000005506
AA Change: C61R

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 283 315 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 332 357 N/A INTRINSIC
RRM 403 476 1.71e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068747
AA Change: C61R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070438
Gene: ENSMUSG00000005506
AA Change: C61R

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111448
AA Change: C61R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107075
Gene: ENSMUSG00000005506
AA Change: C61R

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 252 272 N/A INTRINSIC
low complexity region 279 311 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 328 353 N/A INTRINSIC
RRM 399 472 1.71e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111449
AA Change: C61R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107076
Gene: ENSMUSG00000005506
AA Change: C61R

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111451
AA Change: C61R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107078
Gene: ENSMUSG00000005506
AA Change: C61R

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111452
AA Change: C88R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107079
Gene: ENSMUSG00000005506
AA Change: C88R

DomainStartEndE-ValueType
RRM 44 122 5.93e-17 SMART
RRM 136 211 2.52e-20 SMART
low complexity region 226 234 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
low complexity region 283 303 N/A INTRINSIC
low complexity region 311 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
RRM 429 502 1.71e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111455
AA Change: C88R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107082
Gene: ENSMUSG00000005506
AA Change: C88R

DomainStartEndE-ValueType
RRM 44 122 5.93e-17 SMART
RRM 136 211 2.52e-20 SMART
low complexity region 226 234 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
low complexity region 283 303 N/A INTRINSIC
low complexity region 311 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
RRM 429 502 1.71e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154442
Predicted Effect probably damaging
Transcript: ENSMUST00000177642
AA Change: C61R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136109
Gene: ENSMUSG00000005506
AA Change: C61R

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in significant postnatal lethality, growth retardation, and impaired fertility in both sexes. Male infertility is caused by a blockage of spermiogenesis at stage 7 and increased germ cell apoptosis but is not fully penetrant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Celf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Celf1 APN 2 91009207 missense possibly damaging 0.83
IGL02126:Celf1 APN 2 91001063 missense probably damaging 1.00
IGL02183:Celf1 APN 2 91001486 missense probably damaging 1.00
IGL02350:Celf1 APN 2 90998588 missense probably damaging 0.97
IGL02357:Celf1 APN 2 90998588 missense probably damaging 0.97
IGL02402:Celf1 APN 2 90998723 missense probably damaging 1.00
IGL02522:Celf1 APN 2 91009301 missense possibly damaging 0.46
R0033:Celf1 UTSW 2 91001453 splice site probably benign
R0033:Celf1 UTSW 2 91001453 splice site probably benign
R0147:Celf1 UTSW 2 91004690 splice site probably benign
R2008:Celf1 UTSW 2 91010408 missense probably damaging 0.97
R2132:Celf1 UTSW 2 91010446 missense probably damaging 1.00
R3769:Celf1 UTSW 2 90998648 missense probably damaging 1.00
R3845:Celf1 UTSW 2 91009238 missense possibly damaging 0.46
R3857:Celf1 UTSW 2 91012741 missense probably damaging 0.98
R3858:Celf1 UTSW 2 91012741 missense probably damaging 0.98
R5287:Celf1 UTSW 2 91009207 missense possibly damaging 0.83
R6395:Celf1 UTSW 2 91003858 missense probably benign 0.01
R6993:Celf1 UTSW 2 91010476 missense probably damaging 1.00
R7063:Celf1 UTSW 2 91012844 critical splice donor site probably null
R7242:Celf1 UTSW 2 91003257 nonsense probably null
R7419:Celf1 UTSW 2 91003243 missense probably benign
X0062:Celf1 UTSW 2 90998594 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTACAGCACCTCTACAGCTC -3'
(R):5'- GCAGCAAGAACTACTTTTGGTC -3'

Sequencing Primer
(F):5'- AGCAGTGCTGTAGGGATA -3'
(R):5'- TTTTCACAGTAATTCCCACAGCAAAG -3'
Posted On2017-03-14