Incidental Mutation 'R5124:Taf4'
ID 470603
Institutional Source Beutler Lab
Gene Symbol Taf4
Ensembl Gene ENSMUSG00000039117
Gene Name TATA-box binding protein associated factor 4
Synonyms TAFII130, Taf2c1, TAFII135, Taf4a
MMRRC Submission 042712-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5124 (G1)
Quality Score 58
Status Validated
Chromosome 2
Chromosomal Location 179553945-179618439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 179573822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 682 (T682M)
Ref Sequence ENSEMBL: ENSMUSP00000153863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]
AlphaFold E9QAP7
Predicted Effect probably damaging
Transcript: ENSMUST00000041618
AA Change: T682M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: T682M

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 64 181 N/A INTRINSIC
SCOP:d1hqva_ 312 325 6e-3 SMART
low complexity region 339 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
internal_repeat_1 465 500 2.85e-5 PROSPERO
low complexity region 537 547 N/A INTRINSIC
TAFH 550 642 4.9e-54 SMART
internal_repeat_1 692 727 2.85e-5 PROSPERO
low complexity region 767 773 N/A INTRINSIC
Pfam:TAF4 791 1039 3.5e-81 PFAM
Predicted Effect not run
Transcript: ENSMUST00000131358
AA Change: T319M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154961
Predicted Effect probably damaging
Transcript: ENSMUST00000227325
AA Change: T682M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2230 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A T 4: 144,401,289 (GRCm39) I65N probably damaging Het
Adpgk A G 9: 59,222,561 (GRCm39) D496G possibly damaging Het
Agbl4 A G 4: 111,513,525 (GRCm39) M424V probably benign Het
Akap10 C T 11: 61,807,015 (GRCm39) A72T probably damaging Het
Bpifa3 C T 2: 153,980,057 (GRCm39) Q230* probably null Het
Cog4 G T 8: 111,573,825 (GRCm39) R48L probably damaging Het
Cop1 A G 1: 159,105,682 (GRCm39) Y33C probably damaging Het
Cyp26a1 A T 19: 37,689,665 (GRCm39) I454L probably benign Het
Ddr1 T C 17: 35,994,489 (GRCm39) H762R probably damaging Het
Dnajc2 A T 5: 21,968,482 (GRCm39) S328T probably benign Het
Dppa2 G T 16: 48,131,986 (GRCm39) V28F probably damaging Het
Dusp15 T A 2: 152,793,275 (GRCm39) M1L possibly damaging Het
Eml5 G A 12: 98,758,301 (GRCm39) T1875M probably damaging Het
Fam186a A G 15: 99,840,977 (GRCm39) S1756P possibly damaging Het
Gm5431 T A 11: 48,779,866 (GRCm39) Q630L probably benign Het
H6pd A G 4: 150,066,512 (GRCm39) S625P possibly damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kcnj6 G T 16: 94,633,518 (GRCm39) P180T probably damaging Het
Lpin3 T A 2: 160,738,981 (GRCm39) M263K probably benign Het
Lrp2 A T 2: 69,331,834 (GRCm39) D1640E probably damaging Het
Lypd2 C T 15: 74,604,347 (GRCm39) A74T probably benign Het
Map4k1 T C 7: 28,688,257 (GRCm39) L223P probably damaging Het
Myh7 A T 14: 55,223,199 (GRCm39) Y715* probably null Het
Myo9b T C 8: 71,808,483 (GRCm39) S1697P probably damaging Het
Neb T C 2: 52,171,510 (GRCm39) E1661G probably damaging Het
Nek8 A T 11: 78,063,765 (GRCm39) M80K probably damaging Het
Nup188 T A 2: 30,220,947 (GRCm39) L979Q probably damaging Het
Or4c113 A T 2: 88,885,431 (GRCm39) V113D probably damaging Het
P4htm T A 9: 108,459,141 (GRCm39) S264C possibly damaging Het
Pcdha8 A G 18: 37,126,768 (GRCm39) T417A probably benign Het
Pclo T C 5: 14,727,406 (GRCm39) probably benign Het
Prox1 T A 1: 189,893,476 (GRCm39) N323I possibly damaging Het
Prune2 A T 19: 17,177,274 (GRCm39) R222S probably damaging Het
Psmd2 C A 16: 20,471,448 (GRCm39) R100S possibly damaging Het
Qrich2 A T 11: 116,337,599 (GRCm39) M1963K probably damaging Het
Rbm39 C T 2: 156,001,082 (GRCm39) G324D probably damaging Het
Rhobtb1 A T 10: 69,105,731 (GRCm39) probably null Het
Rhov G T 2: 119,101,568 (GRCm39) P13T unknown Het
Sec14l3 A G 11: 4,025,209 (GRCm39) D273G possibly damaging Het
Sirpd T A 3: 15,385,639 (GRCm39) R88* probably null Het
Slco2a1 T A 9: 102,927,365 (GRCm39) I86N probably damaging Het
Smg1 A T 7: 117,812,235 (GRCm39) S19T probably benign Het
Stk32a T C 18: 43,438,082 (GRCm39) S194P probably benign Het
Syna G A 5: 134,588,424 (GRCm39) S175L possibly damaging Het
Tmem151b T C 17: 45,858,045 (GRCm39) Y67C probably damaging Het
Tshz1 C T 18: 84,033,592 (GRCm39) R272Q probably damaging Het
Tti1 A G 2: 157,850,115 (GRCm39) S375P probably damaging Het
Vcan T C 13: 89,873,636 (GRCm39) K73E probably damaging Het
Vmn1r202 C T 13: 22,685,920 (GRCm39) V166I probably benign Het
Vmn2r10 A G 5: 109,154,286 (GRCm39) V6A probably benign Het
Zfhx4 A G 3: 5,307,107 (GRCm39) D111G probably damaging Het
Zhx1 C G 15: 57,917,470 (GRCm39) G259R probably damaging Het
Other mutations in Taf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Taf4 APN 2 179,618,418 (GRCm39) missense unknown
IGL00517:Taf4 APN 2 179,566,206 (GRCm39) splice site probably benign
IGL02159:Taf4 APN 2 179,580,263 (GRCm39) missense probably benign 0.24
IGL02254:Taf4 APN 2 179,562,977 (GRCm39) missense probably benign 0.25
IGL03366:Taf4 APN 2 179,576,847 (GRCm39) missense probably damaging 1.00
R0049:Taf4 UTSW 2 179,565,884 (GRCm39) missense probably damaging 0.98
R0049:Taf4 UTSW 2 179,565,884 (GRCm39) missense probably damaging 0.98
R1267:Taf4 UTSW 2 179,571,117 (GRCm39) missense possibly damaging 0.46
R1495:Taf4 UTSW 2 179,574,820 (GRCm39) missense probably damaging 1.00
R1560:Taf4 UTSW 2 179,577,746 (GRCm39) missense probably benign 0.14
R1756:Taf4 UTSW 2 179,618,324 (GRCm39) missense unknown
R1893:Taf4 UTSW 2 179,574,823 (GRCm39) missense probably damaging 0.98
R1932:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R2213:Taf4 UTSW 2 179,577,683 (GRCm39) critical splice donor site probably null
R3896:Taf4 UTSW 2 179,573,807 (GRCm39) missense probably benign 0.45
R4050:Taf4 UTSW 2 179,573,805 (GRCm39) missense probably damaging 1.00
R4448:Taf4 UTSW 2 179,577,764 (GRCm39) missense possibly damaging 0.65
R4736:Taf4 UTSW 2 179,566,287 (GRCm39) missense probably damaging 1.00
R6155:Taf4 UTSW 2 179,555,317 (GRCm39) missense probably damaging 1.00
R6238:Taf4 UTSW 2 179,573,832 (GRCm39) missense probably damaging 0.97
R6292:Taf4 UTSW 2 179,565,780 (GRCm39) missense probably damaging 1.00
R7749:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7751:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7752:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7754:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7835:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7879:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7880:Taf4 UTSW 2 179,577,726 (GRCm39) nonsense probably null
R7880:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7883:Taf4 UTSW 2 179,571,088 (GRCm39) missense probably damaging 1.00
R7899:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7902:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7905:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R9743:Taf4 UTSW 2 179,581,592 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACCACACGTCTTTCCAGCAG -3'
(R):5'- TGTGCCTGACCCTACATGTCTG -3'

Sequencing Primer
(F):5'- GGAGCTTCCTTGCCTGC -3'
(R):5'- AGCTTACCTGCCTTGAGACAG -3'
Posted On 2017-03-23