Incidental Mutation 'R5156:Rfx4'
ID470609
Institutional Source Beutler Lab
Gene Symbol Rfx4
Ensembl Gene ENSMUSG00000020037
Gene Nameregulatory factor X, 4 (influences HLA class II expression)
Synonyms4933412G19Rik
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location84756062-84906538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84868354 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 238 (Y238H)
Ref Sequence ENSEMBL: ENSMUSP00000128690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060397] [ENSMUST00000095388] [ENSMUST00000166696]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000020226
Predicted Effect probably damaging
Transcript: ENSMUST00000060397
AA Change: Y381H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051107
Gene: ENSMUSG00000020037
AA Change: Y381H

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 58 136 7.9e-37 PFAM
Blast:HisKA 293 356 5e-7 BLAST
low complexity region 503 515 N/A INTRINSIC
low complexity region 521 537 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095388
AA Change: Y287H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093035
Gene: ENSMUSG00000020037
AA Change: Y287H

DomainStartEndE-ValueType
SCOP:d1kwha_ 11 201 6e-3 SMART
Blast:HisKA 199 262 4e-7 BLAST
low complexity region 409 421 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166696
AA Change: Y238H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128690
Gene: ENSMUSG00000020037
AA Change: Y238H

DomainStartEndE-ValueType
Blast:HisKA 150 213 6e-7 BLAST
low complexity region 360 372 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Inactivating null allele or homozygous point mutation alleles exhibit missing dorsal midline structure of the cortex including the subcommissural organ and neonatal lethality. Heterozygous null mice have congenital hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Rfx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Rfx4 APN 10 84840199 missense probably damaging 1.00
IGL00334:Rfx4 APN 10 84780053 missense possibly damaging 0.91
IGL00928:Rfx4 APN 10 84840114 missense probably benign 0.04
IGL01063:Rfx4 APN 10 84868382 missense possibly damaging 0.90
IGL01490:Rfx4 APN 10 84840851 missense possibly damaging 0.85
IGL02390:Rfx4 APN 10 84840150 missense probably damaging 1.00
IGL02454:Rfx4 APN 10 84840106 missense possibly damaging 0.83
R0099:Rfx4 UTSW 10 84894304 missense probably benign
R0503:Rfx4 UTSW 10 84894332 missense possibly damaging 0.56
R0924:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R0930:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R1386:Rfx4 UTSW 10 84863285 missense probably damaging 1.00
R1715:Rfx4 UTSW 10 84844280 missense probably damaging 1.00
R1738:Rfx4 UTSW 10 84880975 critical splice donor site probably null
R1987:Rfx4 UTSW 10 84896088 missense possibly damaging 0.87
R3717:Rfx4 UTSW 10 84880224 missense probably damaging 1.00
R4231:Rfx4 UTSW 10 84814694 missense probably benign 0.03
R4300:Rfx4 UTSW 10 84905102 missense probably damaging 0.98
R4581:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4582:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4618:Rfx4 UTSW 10 84880896 missense probably benign 0.01
R5185:Rfx4 UTSW 10 84863250 missense probably damaging 1.00
R5377:Rfx4 UTSW 10 84860542 missense possibly damaging 0.81
R5601:Rfx4 UTSW 10 84798578 missense probably damaging 1.00
R5879:Rfx4 UTSW 10 84814761 critical splice donor site probably null
R5996:Rfx4 UTSW 10 84840017 nonsense probably null
R6358:Rfx4 UTSW 10 84844235 missense probably damaging 1.00
R6805:Rfx4 UTSW 10 84840228 missense possibly damaging 0.86
R7248:Rfx4 UTSW 10 84905055 missense probably benign 0.05
X0024:Rfx4 UTSW 10 84780074 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGCTAGCCAGTGTTATTAATGAGG -3'
(R):5'- TAGCTCACCCTGGGATTCTG -3'

Sequencing Primer
(F):5'- TGGTAACATGCTATGAGAGATGTG -3'
(R):5'- GTGCTACTTAGGTGTCCATAGAGAC -3'
Posted On2017-03-23