Incidental Mutation 'R5967:1520401A03Rik'
List |< first << previous [record 16 of 18487] next >> last >|
ID470678
Institutional Source Beutler Lab
Gene Symbol 1520401A03Rik
Ensembl Gene ENSMUSG00000043747
Gene NameRIKEN cDNA 1520401A03 gene
Synonyms
MMRRC Submission 043248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5967 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23704488-23722783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23712358 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 192 (G192W)
Ref Sequence ENSEMBL: ENSMUSP00000144253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178006] [ENSMUST00000201734]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176095
Predicted Effect probably damaging
Transcript: ENSMUST00000178006
AA Change: G192W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144253
Gene: ENSMUSG00000043747
AA Change: G192W

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 18 47 N/A INTRINSIC
internal_repeat_1 49 75 7.63e-5 PROSPERO
low complexity region 82 99 N/A INTRINSIC
internal_repeat_1 101 132 7.63e-5 PROSPERO
low complexity region 133 164 N/A INTRINSIC
low complexity region 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201734
SMART Domains Protein: ENSMUSP00000144664
Gene: ENSMUSG00000043747

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 87 116 N/A INTRINSIC
internal_repeat_1 117 149 3.72e-8 PROSPERO
low complexity region 151 168 N/A INTRINSIC
low complexity region 202 233 N/A INTRINSIC
low complexity region 238 258 N/A INTRINSIC
internal_repeat_1 268 310 3.72e-8 PROSPERO
low complexity region 518 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T A 3: 116,793,708 D66V probably benign Het
Agrn G A 4: 156,175,103 P792S probably damaging Het
AI464131 G A 4: 41,497,830 A600V probably benign Het
Angptl2 A G 2: 33,228,706 N164S probably damaging Het
Birc6 T C 17: 74,660,439 F4112L probably damaging Het
C8b A G 4: 104,793,333 E446G possibly damaging Het
Ceacam1 C T 7: 25,474,742 V163I probably damaging Het
Cngb1 T C 8: 95,251,906 K1068R probably damaging Het
Gna11 A G 10: 81,530,809 Y356H probably benign Het
Gnl2 A G 4: 125,041,030 M160V probably benign Het
Gpsm1 A G 2: 26,340,534 probably null Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Kif20a G T 18: 34,630,527 R609L probably benign Het
Meis2 G A 2: 115,864,309 T444I probably benign Het
Muc3 T A 5: 137,146,637 I62L probably benign Het
Ncor2 C T 5: 125,068,984 D526N unknown Het
Nodal G T 10: 61,423,667 E294D probably damaging Het
Nup214 T C 2: 31,979,778 V161A possibly damaging Het
Olfr1029 G A 2: 85,976,191 R316H probably benign Het
Olfr172 G T 16: 58,760,362 D271E probably damaging Het
Olfr514 C T 7: 108,825,714 G95D probably benign Het
Pclo A T 5: 14,540,655 T990S unknown Het
Piwil2 A T 14: 70,390,564 M752K probably benign Het
Ppargc1b A G 18: 61,298,766 S1004P probably damaging Het
Prkd1 A T 12: 50,364,550 M805K probably damaging Het
Rad23a T C 8: 84,838,939 E30G probably damaging Het
Ralbp1 A G 17: 65,864,279 V233A probably benign Het
Scin C T 12: 40,077,538 E418K probably benign Het
Scn7a T A 2: 66,675,713 I1611F probably damaging Het
Slit2 A T 5: 47,985,164 H42L probably damaging Het
Stard9 T A 2: 120,706,894 V4259D probably damaging Het
Trhde T A 10: 114,567,134 Y528F probably damaging Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Zfp715 T C 7: 43,299,148 T463A probably benign Het
Other mutations in 1520401A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0332:1520401A03Rik UTSW 17 23714604 splice site probably benign
R1165:1520401A03Rik UTSW 17 23710515 splice site probably benign
R1539:1520401A03Rik UTSW 17 23717144 splice site probably benign
R2968:1520401A03Rik UTSW 17 23715811 missense possibly damaging 0.90
R5459:1520401A03Rik UTSW 17 23711843 intron probably benign
R5800:1520401A03Rik UTSW 17 23717992 missense probably damaging 0.96
R6246:1520401A03Rik UTSW 17 23710491 nonsense probably null
R6306:1520401A03Rik UTSW 17 23706150 missense possibly damaging 0.66
R6892:1520401A03Rik UTSW 17 23712354 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACCATTCTGAGCTGGAGG -3'
(R):5'- ATGACTATGGACCAGGCAGG -3'

Sequencing Primer
(F):5'- ATTCTGAGCTGGAGGCCCTG -3'
(R):5'- TGTCTTTCCTCCAGGCTACGAAG -3'
Posted On2017-03-31