Incidental Mutation 'R5968:Adgrf2'
ID470714
Institutional Source Beutler Lab
Gene Symbol Adgrf2
Ensembl Gene ENSMUSG00000057899
Gene Nameadhesion G protein-coupled receptor F2
SynonymsGpr111, PGR20
MMRRC Submission 043249-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5968 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location42708936-42742179 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 42715172 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113614]
Predicted Effect probably null
Transcript: ENSMUST00000113614
SMART Domains Protein: ENSMUSP00000109244
Gene: ENSMUSG00000057899

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 325 376 2.05e-4 SMART
Pfam:7tm_2 378 625 4.1e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,310,151 T978A probably benign Het
Adcy9 A G 16: 4,298,742 L638P probably damaging Het
Anxa6 T C 11: 54,994,341 I461V probably damaging Het
Arap1 T C 7: 101,394,738 L668P probably damaging Het
B020031M17Rik T C 13: 119,950,082 probably benign Het
Ccdc144b T C 3: 36,010,691 Q511R probably benign Het
Ces2e G T 8: 104,932,995 G498W probably damaging Het
Crb1 A G 1: 139,243,001 C823R probably damaging Het
Ehmt1 C T 2: 24,836,457 R772H probably damaging Het
Enpep A G 3: 129,280,938 L721S probably benign Het
Flii T G 11: 60,720,212 I464L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ift172 T C 5: 31,261,484 E1162G probably damaging Het
Meioc A G 11: 102,675,831 S758G probably damaging Het
Ndst1 A C 18: 60,713,076 S54A probably benign Het
Ndufaf8 G T 11: 120,099,229 E56* probably null Het
Ndufb7 A G 8: 83,566,901 D28G probably benign Het
Olfr1 T C 11: 73,395,192 M277V possibly damaging Het
Olfr447 A G 6: 42,911,546 I8V probably benign Het
Prkg1 A T 19: 30,592,924 F443I probably damaging Het
Pspc1 C T 14: 56,764,236 R227H probably benign Het
Ptpn21 A G 12: 98,710,890 Y120H probably damaging Het
Runx1t1 A T 4: 13,841,890 probably null Het
Ryr3 T C 2: 112,647,049 D4449G probably benign Het
Sacs C A 14: 61,189,629 A159E probably damaging Het
Slc16a14 T C 1: 84,912,505 I360V possibly damaging Het
Thop1 A G 10: 81,075,559 D93G probably benign Het
Tmem92 A C 11: 94,778,738 M85R probably benign Het
Ttn T C 2: 76,857,673 probably benign Het
Zdhhc5 T C 2: 84,694,375 probably null Het
Zfp335 T C 2: 164,892,394 H1291R probably damaging Het
Zfp957 C T 14: 79,214,056 C101Y probably damaging Het
Other mutations in Adgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adgrf2 APN 17 42714315 splice site probably benign
IGL01089:Adgrf2 APN 17 42710158 missense probably damaging 1.00
IGL01601:Adgrf2 APN 17 42710049 missense probably benign
IGL01765:Adgrf2 APN 17 42719535 missense probably benign 0.06
IGL02946:Adgrf2 APN 17 42710493 missense probably damaging 1.00
R0498:Adgrf2 UTSW 17 42714315 splice site probably benign
R0720:Adgrf2 UTSW 17 42713172 missense probably damaging 1.00
R0831:Adgrf2 UTSW 17 42710443 missense probably damaging 0.96
R1664:Adgrf2 UTSW 17 42714414 missense possibly damaging 0.92
R2008:Adgrf2 UTSW 17 42710122 missense probably damaging 0.96
R2306:Adgrf2 UTSW 17 42713119 missense possibly damaging 0.92
R2519:Adgrf2 UTSW 17 42710407 missense probably damaging 1.00
R3713:Adgrf2 UTSW 17 42713088 missense probably damaging 1.00
R3736:Adgrf2 UTSW 17 42711012 missense probably benign 0.32
R4272:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4273:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4422:Adgrf2 UTSW 17 42713155 missense probably benign
R4732:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4733:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4906:Adgrf2 UTSW 17 42711193 missense probably benign
R5053:Adgrf2 UTSW 17 42710443 missense probably damaging 0.96
R5078:Adgrf2 UTSW 17 42710986 missense probably damaging 1.00
R5089:Adgrf2 UTSW 17 42710097 missense probably benign 0.00
R5147:Adgrf2 UTSW 17 42710683 missense probably damaging 0.99
R5953:Adgrf2 UTSW 17 42710338 missense probably damaging 1.00
R6791:Adgrf2 UTSW 17 42710883 missense probably benign 0.02
R7138:Adgrf2 UTSW 17 42710983 missense probably damaging 1.00
X0061:Adgrf2 UTSW 17 42713074 missense probably benign 0.37
X0067:Adgrf2 UTSW 17 42710668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCGATGAGAATTCTGTAGC -3'
(R):5'- AAGTCATCGGGCCATTTGCG -3'

Sequencing Primer
(F):5'- AGAAGATATGACTATTGCTAGGACC -3'
(R):5'- ATTTGCGACAGCTGGGC -3'
Posted On2017-03-31