Mutagenetix > Incidental Mutation

Incidental Mutation 'R5969:Fxyd2'

470748

Institutional Source

Beutler Lab

Gene Symbol

Fxyd2

Ensembl Gene

ENSMUSG00000059412

Gene Name

FXYD domain-containing ion transport regulator 2

Synonyms

Atp1g1

MMRRC Submission

044152-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5969 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45311007-45321576 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 45319628 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 30 (I30N)

Ref Sequence

ENSEMBL: ENSMUSP00000150658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041005] [ENSMUST00000214257] [ENSMUST00000214466] [ENSMUST00000216289]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041005
AA Change: I30N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035429
Gene: ENSMUSG00000059412
AA Change: I30N

Domain	Start	End	E-Value	Type
Pfam:ATP1G1_PLM_MAT8	10	60	1.6e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213282

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214017

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214245

Predicted Effect

probably benign
Transcript: ENSMUST00000214257

Predicted Effect

probably damaging
Transcript: ENSMUST00000214466
AA Change: I30N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000216289
AA Change: I30N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214680

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217549

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214654

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216840

Meta Mutation Damage Score

0.8436

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The Type III integral membrane protein encoded by this gene is the gamma subunit of the Na,K-ATPase present on the plasma membrane. Although the Na,K-ATPase does not depend on the gamma subunit to be functional, it is thought that the gamma subunit modulates the enzyme's activity by inducing ion channel activity. Multiple transcript variants have been described for this gene that are expressed in tissue-specific and developmental stage-specific patterns and encode proteins that differ at the N-terminus. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice are viable and fertile but display abnormal renal NaK-ATPase kinetics. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaas	A	C	15: 102,258,999 (GRCm39)	Y19D	probably damaging	Het
Abca13	T	A	11: 9,242,214 (GRCm39)	L1359*	probably null	Het
Ahi1	A	T	10: 20,860,292 (GRCm39)	D671V	probably damaging	Het
Ahnak	T	C	19: 8,993,949 (GRCm39)	S5078P	probably damaging	Het
Ankhd1	A	T	18: 36,733,887 (GRCm39)	T584S	probably damaging	Het
Apba2	T	A	7: 64,394,195 (GRCm39)	L568*	probably null	Het
Cenpn	C	A	8: 117,667,276 (GRCm39)	L300I	probably damaging	Het
Cmya5	A	T	13: 93,226,052 (GRCm39)	L3012Q	possibly damaging	Het
Cnnm1	T	C	19: 43,479,911 (GRCm39)	S819P	probably damaging	Het
Cpa6	A	T	1: 10,559,108 (GRCm39)	S87T	probably benign	Het
Crybg2	T	A	4: 133,803,003 (GRCm39)		probably null	Het
Csmd1	T	A	8: 16,121,367 (GRCm39)	T1777S	probably benign	Het
Csmd3	G	T	15: 47,811,386 (GRCm39)	P1235Q	probably damaging	Het
Cxcr4	T	A	1: 128,517,584 (GRCm39)	N24Y	probably benign	Het
D630003M21Rik	G	T	2: 158,059,628 (GRCm39)	H91N	probably damaging	Het
Ece1	T	C	4: 137,689,051 (GRCm39)		probably null	Het
Edc3	T	C	9: 57,620,711 (GRCm39)	S11P	probably damaging	Het
Eif1ad14	T	C	12: 87,886,248 (GRCm39)	D127G	unknown	Het
Exoc3	G	A	13: 74,320,305 (GRCm39)	Q719*	probably null	Het
Fam13a	A	G	6: 58,942,183 (GRCm39)	M203T	probably damaging	Het
Fchsd1	C	T	18: 38,092,926 (GRCm39)		probably benign	Het
Fhip2a	C	T	19: 57,372,555 (GRCm39)	R602*	probably null	Het
Gapt	A	G	13: 110,490,480 (GRCm39)	V61A	probably benign	Het
Glb1l2	C	T	9: 26,692,038 (GRCm39)	A74T	probably damaging	Het
Gpr35	T	C	1: 92,910,942 (GRCm39)	V2A	probably damaging	Het
Gtf3c1	A	G	7: 125,244,848 (GRCm39)	S1729P	possibly damaging	Het
Heatr5a	T	C	12: 52,005,823 (GRCm39)	T51A	probably benign	Het
Kat6b	G	A	14: 21,720,860 (GRCm39)	M1737I	probably damaging	Het
Kif20a	G	A	18: 34,765,468 (GRCm39)	A822T	probably benign	Het
Klk10	A	G	7: 43,434,409 (GRCm39)	Y267C	probably damaging	Het
Lgmn	T	C	12: 102,372,086 (GRCm39)	Y98C	probably damaging	Het
Lyst	A	C	13: 13,862,398 (GRCm39)		probably null	Het
Man2a1	A	G	17: 64,932,375 (GRCm39)	K154R	probably benign	Het
Mfng	A	T	15: 78,648,582 (GRCm39)	V165D	possibly damaging	Het
Mto1	A	G	9: 78,360,187 (GRCm39)	E225G	probably damaging	Het
Notch3	C	A	17: 32,372,858 (GRCm39)	C571F	probably damaging	Het
Nup205	C	T	6: 35,154,513 (GRCm39)		probably benign	Het
Or51b6	T	A	7: 103,556,117 (GRCm39)	I157N	probably damaging	Het
P2ry14	T	A	3: 59,022,579 (GRCm39)	I303F	probably damaging	Het
Pcnx3	T	C	19: 5,735,563 (GRCm39)	D421G	probably damaging	Het
Pdlim4	T	C	11: 53,954,482 (GRCm39)	H75R	possibly damaging	Het
Phf21a	A	T	2: 92,051,956 (GRCm39)	H17L	probably damaging	Het
Ppid	T	A	3: 79,505,024 (GRCm39)	N122K	probably damaging	Het
Ppp4r3a	T	C	12: 101,009,838 (GRCm39)	I613V	probably benign	Het
Prcp	C	T	7: 92,566,974 (GRCm39)	P229S	probably benign	Het
Ralgds	T	C	2: 28,432,426 (GRCm39)	V85A	probably damaging	Het
Rgs22	G	A	15: 36,015,782 (GRCm39)	T1034I	probably benign	Het
Slc4a3	T	C	1: 75,526,623 (GRCm39)	V48A	probably damaging	Het
Snx16	A	T	3: 10,503,217 (GRCm39)	M10K	possibly damaging	Het
Svep1	G	A	4: 58,070,977 (GRCm39)	Q2270*	probably null	Het
Tmem185b	T	G	1: 119,455,193 (GRCm39)	I318S	probably benign	Het
Tnik	C	T	3: 28,675,097 (GRCm39)	R657C	probably damaging	Het
Top3b	T	C	16: 16,701,429 (GRCm39)		probably null	Het
Trim40	C	T	17: 37,193,319 (GRCm39)	R203H	probably benign	Het
Triobp	T	A	15: 78,851,740 (GRCm39)	N631K	probably benign	Het
Ubr3	T	G	2: 69,809,730 (GRCm39)	Y1233*	probably null	Het
Vgll3	A	G	16: 65,636,449 (GRCm39)	D200G	probably damaging	Het
Vmn2r24	G	A	6: 123,755,981 (GRCm39)	E18K	probably benign	Het
Zfp141	C	A	7: 42,138,912 (GRCm39)	R40L	probably damaging	Het

Other mutations in Fxyd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R6415:Fxyd2	UTSW	9	45,314,592 (GRCm39)	missense	possibly damaging	0.81
R8999:Fxyd2	UTSW	9	45,314,295 (GRCm39)	intron	probably benign
R9153:Fxyd2	UTSW	9	45,319,609 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCCTTCGAGTACGGTAAGC -3'
(R):5'- CTCAAGGGATAGGGTGGCTTAG -3'

Sequencing Primer
(F):5'- TAAGCCGGTCCTCCCCTG -3'
(R):5'- AGTTGCCCAGCCAGACTTC -3'

Posted On

2017-03-31