Incidental Mutation 'R0501:Mcm6'
ID47076
Institutional Source Beutler Lab
Gene Symbol Mcm6
Ensembl Gene ENSMUSG00000026355
Gene Nameminichromosome maintenance complex component 6
SynonymsD1Wsu22e, Mcmd6
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128331590-128359664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128355636 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 44 (I44T)
Ref Sequence ENSEMBL: ENSMUSP00000140308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000190495]
Predicted Effect probably benign
Transcript: ENSMUST00000027601
AA Change: I44T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: I44T

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 821 1e-47 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190495
AA Change: I44T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: I44T

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 783 3e-29 PDB
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Mcm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Mcm6 APN 1 128344383 missense probably damaging 1.00
IGL01420:Mcm6 APN 1 128345875 missense probably damaging 1.00
IGL01746:Mcm6 APN 1 128353524 nonsense probably null
IGL02256:Mcm6 APN 1 128335728 critical splice donor site probably null
IGL02624:Mcm6 APN 1 128349448 missense possibly damaging 0.91
IGL02732:Mcm6 APN 1 128359490 missense probably benign 0.16
IGL02750:Mcm6 APN 1 128343472 missense probably damaging 1.00
IGL02926:Mcm6 APN 1 128339382 missense probably damaging 1.00
IGL03189:Mcm6 APN 1 128344302 missense probably damaging 1.00
IGL03238:Mcm6 APN 1 128355520 missense probably benign 0.13
IGL03397:Mcm6 APN 1 128344302 missense probably damaging 1.00
R0453:Mcm6 UTSW 1 128333555 missense probably benign 0.00
R0885:Mcm6 UTSW 1 128348933 missense probably benign 0.00
R1013:Mcm6 UTSW 1 128349041 missense probably benign
R1319:Mcm6 UTSW 1 128349052 missense probably benign
R1396:Mcm6 UTSW 1 128351476 missense probably damaging 1.00
R1656:Mcm6 UTSW 1 128349418 missense possibly damaging 0.90
R1891:Mcm6 UTSW 1 128335810 missense probably damaging 1.00
R1950:Mcm6 UTSW 1 128345989 missense probably benign 0.35
R3411:Mcm6 UTSW 1 128351585 missense probably benign 0.35
R4564:Mcm6 UTSW 1 128343459 missense probably damaging 1.00
R4626:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4627:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4628:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4916:Mcm6 UTSW 1 128348977 missense probably damaging 1.00
R4965:Mcm6 UTSW 1 128359486 missense probably damaging 1.00
R4967:Mcm6 UTSW 1 128335849 missense probably damaging 1.00
R5016:Mcm6 UTSW 1 128343427 missense probably damaging 1.00
R5204:Mcm6 UTSW 1 128333638 missense probably benign 0.01
R5229:Mcm6 UTSW 1 128333584 missense possibly damaging 0.82
R5607:Mcm6 UTSW 1 128355589 missense probably damaging 1.00
R5811:Mcm6 UTSW 1 128335728 critical splice donor site probably benign
R5816:Mcm6 UTSW 1 128348455 missense probably benign 0.01
R7204:Mcm6 UTSW 1 128338127 missense probably damaging 1.00
R7316:Mcm6 UTSW 1 128359508 missense probably damaging 1.00
Z1088:Mcm6 UTSW 1 128344298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTACCTACCCCAGGGGAGAGAT -3'
(R):5'- ACATACTGAATGTGGACTCTGAGCCT -3'

Sequencing Primer
(F):5'- GACCTGCATCAATAGTAACTGTGAC -3'
(R):5'- ATGTGGACTCTGAGCCTAAACTG -3'
Posted On2013-06-12