Incidental Mutation 'R5969:Pcnx3'
ID470778
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Namepecanex homolog 3
SynonymsPcnxl3
MMRRC Submission 044152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5969 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5664635-5688908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5685535 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 421 (D421G)
Ref Sequence ENSEMBL: ENSMUSP00000109245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156] [ENSMUST00000068169] [ENSMUST00000113615] [ENSMUST00000141577]
Predicted Effect probably benign
Transcript: ENSMUST00000004156
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068169
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113615
AA Change: D421G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: D421G

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127876
SMART Domains Protein: ENSMUSP00000123696
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 69 75 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135119
Predicted Effect probably benign
Transcript: ENSMUST00000141577
SMART Domains Protein: ENSMUSP00000116451
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 104 110 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
transmembrane domain 207 224 N/A INTRINSIC
transmembrane domain 229 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145270
SMART Domains Protein: ENSMUSP00000116493
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 199 205 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 240 257 N/A INTRINSIC
transmembrane domain 270 292 N/A INTRINSIC
transmembrane domain 302 321 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 402 421 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
transmembrane domain 498 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147161
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,350,564 Y19D probably damaging Het
Abca13 T A 11: 9,292,214 L1359* probably null Het
Ahi1 A T 10: 20,984,393 D671V probably damaging Het
Ahnak T C 19: 9,016,585 S5078P probably damaging Het
Ankhd1 A T 18: 36,600,834 T584S probably damaging Het
Apba2 T A 7: 64,744,447 L568* probably null Het
Cenpn C A 8: 116,940,537 L300I probably damaging Het
Cmya5 A T 13: 93,089,544 L3012Q possibly damaging Het
Cnnm1 T C 19: 43,491,472 S819P probably damaging Het
Cpa6 A T 1: 10,488,883 S87T probably benign Het
Crybg2 T A 4: 134,075,692 probably null Het
Csmd1 T A 8: 16,071,353 T1777S probably benign Het
Csmd3 G T 15: 47,947,990 P1235Q probably damaging Het
Cxcr4 T A 1: 128,589,847 N24Y probably benign Het
D630003M21Rik G T 2: 158,217,708 H91N probably damaging Het
Ece1 T C 4: 137,961,740 probably null Het
Edc3 T C 9: 57,713,428 S11P probably damaging Het
Exoc3 G A 13: 74,172,186 Q719* probably null Het
Fam13a A G 6: 58,965,198 M203T probably damaging Het
Fam160b1 C T 19: 57,384,123 R602* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fxyd2 T A 9: 45,408,330 I30N probably damaging Het
Gapt A G 13: 110,353,946 V61A probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gm2035 T C 12: 87,919,478 D127G unknown Het
Gpr35 T C 1: 92,983,220 V2A probably damaging Het
Gtf3c1 A G 7: 125,645,676 S1729P possibly damaging Het
Heatr5a T C 12: 51,959,040 T51A probably benign Het
Kat6b G A 14: 21,670,792 M1737I probably damaging Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klk10 A G 7: 43,784,985 Y267C probably damaging Het
Lgmn T C 12: 102,405,827 Y98C probably damaging Het
Lyst A C 13: 13,687,813 probably null Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mfng A T 15: 78,764,382 V165D possibly damaging Het
Mto1 A G 9: 78,452,905 E225G probably damaging Het
Notch3 C A 17: 32,153,884 C571F probably damaging Het
Nup205 C T 6: 35,177,578 probably benign Het
Olfr65 T A 7: 103,906,910 I157N probably damaging Het
P2ry14 T A 3: 59,115,158 I303F probably damaging Het
Pdlim4 T C 11: 54,063,656 H75R possibly damaging Het
Phf21a A T 2: 92,221,611 H17L probably damaging Het
Ppid T A 3: 79,597,717 N122K probably damaging Het
Ppp4r3a T C 12: 101,043,579 I613V probably benign Het
Prcp C T 7: 92,917,766 P229S probably benign Het
Ralgds T C 2: 28,542,414 V85A probably damaging Het
Rgs22 G A 15: 36,015,636 T1034I probably benign Het
Slc4a3 T C 1: 75,549,979 V48A probably damaging Het
Snx16 A T 3: 10,438,157 M10K possibly damaging Het
Svep1 G A 4: 58,070,977 Q2270* probably null Het
Tmem185b T G 1: 119,527,463 I318S probably benign Het
Tnik C T 3: 28,620,948 R657C probably damaging Het
Top3b T C 16: 16,883,565 probably null Het
Trim40 C T 17: 36,882,427 R203H probably benign Het
Triobp T A 15: 78,967,540 N631K probably benign Het
Ubr3 T G 2: 69,979,386 Y1233* probably null Het
Vgll3 A G 16: 65,839,563 D200G probably damaging Het
Vmn2r24 G A 6: 123,779,022 E18K probably benign Het
Zfp141 C A 7: 42,489,488 R40L probably damaging Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5667259 unclassified probably benign
IGL01667:Pcnx3 APN 19 5686630 missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5667476 missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5665337 nonsense probably null
IGL01791:Pcnx3 APN 19 5673267 missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5677663 missense probably benign
IGL01987:Pcnx3 APN 19 5677479 missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5679386 missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5686481 missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5685395 missense probably damaging 1.00
PIT4453001:Pcnx3 UTSW 19 5672756 critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5665583 missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5684333 missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5677728 splice site probably benign
R0840:Pcnx3 UTSW 19 5685701 unclassified probably null
R0907:Pcnx3 UTSW 19 5671525 missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5665516 missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5685347 nonsense probably null
R1602:Pcnx3 UTSW 19 5672515 missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5686065 missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5673315 missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5672656 missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5672587 missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5671556 missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5667605 missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5683339 nonsense probably null
R2358:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R2871:Pcnx3 UTSW 19 5683746 intron probably benign
R3699:Pcnx3 UTSW 19 5672465 missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5683339 nonsense probably null
R3712:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R3798:Pcnx3 UTSW 19 5678668 nonsense probably null
R3856:Pcnx3 UTSW 19 5678967 missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5683780 splice site probably benign
R4613:Pcnx3 UTSW 19 5667219 missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5687130 missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5687995 critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5672596 missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5681579 intron probably benign
R5950:Pcnx3 UTSW 19 5667158 missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5671680 missense possibly damaging 0.71
R6543:Pcnx3 UTSW 19 5665247 missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5686487 missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5672615 missense probably damaging 1.00
X0028:Pcnx3 UTSW 19 5684427 missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5686622 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTTTTGGCACTGGCAGTAC -3'
(R):5'- AGTCATTGGAGCAGGGACAC -3'

Sequencing Primer
(F):5'- TTAGGGGGCACAGCAGTTC -3'
(R):5'- GAGCAGGGACACCACCG -3'
Posted On2017-03-31