Mutagenetix > Incidental Mutations

Incidental Mutation 'R5971:1700012B07Rik'

470853

Institutional Source

Beutler Lab

Gene Symbol

1700012B07Rik

Ensembl Gene

ENSMUSG00000020617

Gene Name

RIKEN cDNA 1700012B07 gene

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.021) question?

Stock #

R5971 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109787651-109828046 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 109794154 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 172 (C172*)

Ref Sequence

ENSEMBL: ENSMUSP00000102285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020941] [ENSMUST00000106674] [ENSMUST00000143578]

Predicted Effect

probably null
Transcript: ENSMUST00000020941
AA Change: C172*

SMART Domains

Protein: ENSMUSP00000020941
Gene: ENSMUSG00000020617
AA Change: C172*

Domain	Start	End	E-Value	Type
low complexity region	41	46	N/A	INTRINSIC
low complexity region	61	71	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106674
AA Change: C172*

SMART Domains

Protein: ENSMUSP00000102285
Gene: ENSMUSG00000020617
AA Change: C172*

Domain	Start	End	E-Value	Type
low complexity region	41	46	N/A	INTRINSIC
low complexity region	61	71	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143578

SMART Domains

Protein: ENSMUSP00000115395
Gene: ENSMUSG00000020617

Domain	Start	End	E-Value	Type
low complexity region	33	38	N/A	INTRINSIC
low complexity region	53	63	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147006

Meta Mutation Damage Score

0.6404

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

87% (27/31)

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	G	T	15: 84,987,662	A4D	possibly damaging	Het
6820408C15Rik	T	C	2: 152,440,870	V215A	probably damaging	Het
Abcc9	A	G	6: 142,639,575	F801S	probably damaging	Het
Abhd14a	A	T	9: 106,443,866	S97T	possibly damaging	Het
Adam39	C	T	8: 40,824,593	A7V	probably benign	Het
Anxa10	C	A	8: 62,077,926	M83I	probably benign	Het
Ctnna1	T	C	18: 35,154,514	V92A	probably benign	Het
Gcg	A	G	2: 62,475,804	S150P	probably damaging	Het
Kitl	G	A	10: 100,076,906		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Msl1	G	T	11: 98,798,693	G9C	probably benign	Het
Myo3b	T	C	2: 70,238,899	V494A	possibly damaging	Het
Olfr356	G	A	2: 36,937,229	V37I	probably benign	Het
Pik3c2b	G	A	1: 133,074,627		probably null	Het
Plagl1	G	A	10: 13,127,746	G253R	probably damaging	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ppp4r1	G	A	17: 65,814,348	V268I	possibly damaging	Het
Slc13a1	T	C	6: 24,133,657	T199A	probably benign	Het
Theg	A	G	10: 79,584,755	S159P	probably damaging	Het

Other mutations in 1700012B07Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01916:1700012B07Rik	APN	11	109794111	missense	probably damaging	0.99
IGL03006:1700012B07Rik	APN	11	109827845	missense	probably damaging	0.98
R0626:1700012B07Rik	UTSW	11	109788721	unclassified	probably benign
R1566:1700012B07Rik	UTSW	11	109788806	missense	probably benign	0.01
R1654:1700012B07Rik	UTSW	11	109797399	missense	probably benign	0.36
R2373:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R2405:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R2410:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R2411:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3707:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3708:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3732:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3745:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3783:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3784:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3785:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3805:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3806:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3922:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3926:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4085:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4089:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4110:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4111:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4112:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4171:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4506:1700012B07Rik	UTSW	11	109794261	missense	probably damaging	1.00
R4825:1700012B07Rik	UTSW	11	109791672	missense	probably benign	0.00
R5032:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R5033:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R6078:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R6079:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R6138:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R6354:1700012B07Rik	UTSW	11	109794216	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- ATTCCTCTGTAGATAATGAGTCCGG -3'
(R):5'- GCTTGTCTAACGAAGCACCC -3'

Sequencing Primer
(F):5'- TCCGGAGAATAGATGCTTGCCAATC -3'
(R):5'- ACCCATGCAAACTGGTCCTTTG -3'

Posted On

2017-03-31