Incidental Mutation 'R5951:Pou2f1'
ID470860
Institutional Source Beutler Lab
Gene Symbol Pou2f1
Ensembl Gene ENSMUSG00000026565
Gene NamePOU domain, class 2, transcription factor 1
Synonymsoct-1, Otf1, Oct-1C, Otf-1, Oct-1B, Oct1, Oct-1z, 2810482H01Rik, Oct-1A
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5951 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165865154-166002678 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 165883056 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027850] [ENSMUST00000069609] [ENSMUST00000111426] [ENSMUST00000111427] [ENSMUST00000111429] [ENSMUST00000159212] [ENSMUST00000160260] [ENSMUST00000160908] [ENSMUST00000184643]
Predicted Effect probably benign
Transcript: ENSMUST00000027850
SMART Domains Protein: ENSMUSP00000027850
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
POU 241 315 1.55e-52 SMART
low complexity region 316 332 N/A INTRINSIC
HOX 342 404 2.54e-19 SMART
low complexity region 422 448 N/A INTRINSIC
low complexity region 453 520 N/A INTRINSIC
low complexity region 529 567 N/A INTRINSIC
low complexity region 675 685 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069609
SMART Domains Protein: ENSMUSP00000064000
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 505 572 N/A INTRINSIC
low complexity region 581 619 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082225
SMART Domains Protein: ENSMUSP00000080856
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
POU 233 309 4.88e-27 SMART
low complexity region 310 326 N/A INTRINSIC
HOX 336 398 2.54e-19 SMART
low complexity region 416 442 N/A INTRINSIC
low complexity region 447 514 N/A INTRINSIC
low complexity region 523 561 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111426
AA Change: T532A
SMART Domains Protein: ENSMUSP00000107055
Gene: ENSMUSG00000026565
AA Change: T532A

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 6.7e-55 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 1.3e-21 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111427
AA Change: T532A
SMART Domains Protein: ENSMUSP00000107056
Gene: ENSMUSG00000026565
AA Change: T532A

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
low complexity region 764 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111429
SMART Domains Protein: ENSMUSP00000107057
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159212
SMART Domains Protein: ENSMUSP00000125371
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 1.55e-52 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 2.54e-19 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
low complexity region 715 725 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160260
AA Change: T543A
SMART Domains Protein: ENSMUSP00000124738
Gene: ENSMUSG00000026565
AA Change: T543A

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 542 607 N/A INTRINSIC
low complexity region 616 654 N/A INTRINSIC
low complexity region 762 772 N/A INTRINSIC
low complexity region 775 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160908
SMART Domains Protein: ENSMUSP00000125444
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 516 583 N/A INTRINSIC
low complexity region 592 630 N/A INTRINSIC
low complexity region 738 748 N/A INTRINSIC
low complexity region 751 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176004
SMART Domains Protein: ENSMUSP00000135153
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
low complexity region 149 159 N/A INTRINSIC
low complexity region 162 179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176942
SMART Domains Protein: ENSMUSP00000135052
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 65 94 N/A INTRINSIC
low complexity region 112 154 N/A INTRINSIC
low complexity region 171 186 N/A INTRINSIC
low complexity region 205 226 N/A INTRINSIC
low complexity region 233 251 N/A INTRINSIC
POU 275 349 1.55e-52 SMART
low complexity region 350 366 N/A INTRINSIC
HOX 376 438 2.54e-19 SMART
low complexity region 456 482 N/A INTRINSIC
low complexity region 487 554 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184643
SMART Domains Protein: ENSMUSP00000138962
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184799
Predicted Effect probably benign
Transcript: ENSMUST00000194366
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The OCT1 transcription factor was among the first identified members of the POU transcription factor family (summarized by Sturm et al., 1993 [PubMed 8314572]). Members of this family contain the POU domain, a 160-amino acid region necessary for DNA binding to the octameric sequence ATGCAAAT.[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in prenatal lethality, with earlier lethality on either a 129/Sv or C57BL/6 background than a mixed 129/Sv and C57BL/6 background. Embryos show decreased erythropoiesis and partial penetrance of small lens size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Pou2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Pou2f1 APN 1 165902298 missense probably damaging 1.00
IGL00392:Pou2f1 APN 1 165896590 splice site probably benign
IGL01627:Pou2f1 APN 1 165880433 unclassified probably benign
IGL01707:Pou2f1 APN 1 165915116 missense probably damaging 0.96
IGL02735:Pou2f1 APN 1 165875827 missense probably damaging 1.00
IGL02740:Pou2f1 APN 1 165883116 nonsense probably null
IGL03117:Pou2f1 APN 1 165934813 missense probably benign 0.00
IGL03272:Pou2f1 APN 1 165896480 missense possibly damaging 0.67
R0021:Pou2f1 UTSW 1 165876018 missense probably damaging 1.00
R1437:Pou2f1 UTSW 1 165891830 missense probably damaging 0.98
R2171:Pou2f1 UTSW 1 165880356 unclassified probably benign
R3722:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3789:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3790:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3901:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R4225:Pou2f1 UTSW 1 165911320 missense possibly damaging 0.79
R4459:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4460:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4573:Pou2f1 UTSW 1 165913261 missense probably benign 0.29
R4820:Pou2f1 UTSW 1 165891948 intron probably benign
R4838:Pou2f1 UTSW 1 165916923 missense probably null 1.00
R5579:Pou2f1 UTSW 1 165915162 missense probably damaging 1.00
R5856:Pou2f1 UTSW 1 165915130 missense probably benign 0.14
R6128:Pou2f1 UTSW 1 165875487 unclassified probably benign
R6145:Pou2f1 UTSW 1 165875433 unclassified probably benign
R6216:Pou2f1 UTSW 1 165880320 unclassified probably benign
R6971:Pou2f1 UTSW 1 165931689 missense probably damaging 0.98
R7052:Pou2f1 UTSW 1 165915115 missense possibly damaging 0.59
R7403:Pou2f1 UTSW 1 165911386 missense unknown
R7404:Pou2f1 UTSW 1 165911386 missense unknown
X0022:Pou2f1 UTSW 1 165896456 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTCTGAATGAGGTAACCTTGC -3'
(R):5'- ACTGGGATTTTCTTCGTAAGCC -3'

Sequencing Primer
(F):5'- CTGAATGAGGTAACCTTGCTTACC -3'
(R):5'- GGGATTTTCTTCGTAAGCCTACAAG -3'
Posted On2017-03-31