Incidental Mutation 'R5951:Padi1'
ID470873
Institutional Source Beutler Lab
Gene Symbol Padi1
Ensembl Gene ENSMUSG00000025329
Gene Namepeptidyl arginine deiminase, type I
SynonymsPad type 1, Pdi1
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5951 (G1)
Quality Score210
Status Validated
Chromosome4
Chromosomal Location140812983-140845778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140814829 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 594 (Y594C)
Ref Sequence ENSEMBL: ENSMUSP00000026378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000026378]
Predicted Effect probably benign
Transcript: ENSMUST00000026377
SMART Domains Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 2.1e-38 PFAM
Pfam:PAD_M 115 273 4.2e-61 PFAM
Pfam:PAD 283 661 2.3e-169 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026378
AA Change: Y594C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026378
Gene: ENSMUSG00000025329
AA Change: Y594C

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 5.4e-39 PFAM
Pfam:PAD_M 115 272 1.3e-63 PFAM
Pfam:PAD 280 659 9.4e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151848
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type I enzyme is involved in the late stages of epidermal differentiation, where it deiminates filaggrin and keratin K1, which maintains hydration of the stratum corneum, and hence the cutaneous barrier function. This enzyme may also play a role in hair follicle formation. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Padi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Padi1 APN 4 140829435 missense probably damaging 1.00
IGL01972:Padi1 APN 4 140818859 splice site probably benign
IGL03260:Padi1 APN 4 140828194 missense probably benign 0.11
R0598:Padi1 UTSW 4 140814787 missense possibly damaging 0.84
R1164:Padi1 UTSW 4 140832329 missense possibly damaging 0.50
R1793:Padi1 UTSW 4 140814656 missense probably damaging 1.00
R4208:Padi1 UTSW 4 140817227 missense possibly damaging 0.80
R4256:Padi1 UTSW 4 140814778 missense probably damaging 1.00
R4484:Padi1 UTSW 4 140817270 intron probably benign
R4926:Padi1 UTSW 4 140824847 missense probably damaging 0.99
R4967:Padi1 UTSW 4 140845590 missense probably benign 0.00
R5066:Padi1 UTSW 4 140829437 missense probably damaging 1.00
R5523:Padi1 UTSW 4 140814853 missense probably damaging 1.00
R5622:Padi1 UTSW 4 140824955 missense probably damaging 1.00
R5850:Padi1 UTSW 4 140814830 missense probably benign 0.03
R5870:Padi1 UTSW 4 140826581 missense probably benign 0.39
R6187:Padi1 UTSW 4 140826965 missense probably damaging 1.00
R7257:Padi1 UTSW 4 140829471 missense probably damaging 1.00
R7326:Padi1 UTSW 4 140832404 missense probably benign 0.15
R7339:Padi1 UTSW 4 140829234 missense probably null 0.98
X0024:Padi1 UTSW 4 140828167 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTTTCCTCCGCACGTTG -3'
(R):5'- GAAACATTGTACCACTGAGCTAC -3'

Sequencing Primer
(F):5'- TGGTGCCACAGTGGATCTCTC -3'
(R):5'- CGACTCCCAATTTATAATGGGC -3'
Posted On2017-03-31