Incidental Mutation 'R5951:Hoxc10'
ID470917
Institutional Source Beutler Lab
Gene Symbol Hoxc10
Ensembl Gene ENSMUSG00000022484
Gene Namehomeobox C10
SynonymsHox-3.6
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R5951 (G1)
Quality Score210
Status Validated
Chromosome15
Chromosomal Location102966796-102971893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102967318 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 154 (S154N)
Ref Sequence ENSEMBL: ENSMUSP00000001699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001699]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001699
AA Change: S154N

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001699
Gene: ENSMUSG00000022484
AA Change: S154N

DomainStartEndE-ValueType
low complexity region 143 157 N/A INTRINSIC
HOX 268 330 2.68e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The protein level is controlled during cell differentiation and proliferation, which may indicate this protein has a role in origin activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit skeletal transformations in thoracic, lumbar and sacral vertebrae, alterations in the pelvis and in the bones and ligaments of the hindlimb, femoral defects, decreased lumbar motor neuron and rib number, impairedcoordination, muscle wasting, and obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Hoxc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0630:Hoxc10 UTSW 15 102967482 missense probably benign 0.07
R1529:Hoxc10 UTSW 15 102967200 missense probably damaging 1.00
R1771:Hoxc10 UTSW 15 102967087 missense probably damaging 1.00
R2139:Hoxc10 UTSW 15 102967477 missense probably benign 0.19
R2962:Hoxc10 UTSW 15 102967300 missense probably damaging 1.00
R3849:Hoxc10 UTSW 15 102967444 missense probably benign 0.00
R3850:Hoxc10 UTSW 15 102967444 missense probably benign 0.00
R4507:Hoxc10 UTSW 15 102966952 missense probably damaging 1.00
R4650:Hoxc10 UTSW 15 102967263 missense probably benign 0.02
R5640:Hoxc10 UTSW 15 102967267 missense probably benign 0.39
R6240:Hoxc10 UTSW 15 102970830 missense probably damaging 1.00
R6899:Hoxc10 UTSW 15 102967507 missense possibly damaging 0.83
R7110:Hoxc10 UTSW 15 102970921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAACAACCTGTTGGCAG -3'
(R):5'- TATCCGAGGTGTCTGGACTG -3'

Sequencing Primer
(F):5'- CTGTTGGCAGGCCTCTGTC -3'
(R):5'- GCTCTGTCTTGATCTCATTGGGAC -3'
Posted On2017-03-31