Incidental Mutation 'R5951:Ehmt2'
ID470919
Institutional Source Beutler Lab
Gene Symbol Ehmt2
Ensembl Gene ENSMUSG00000013787
Gene Nameeuchromatic histone lysine N-methyltransferase 2
SynonymsNG36, D17Ertd710e, G9a, KMT1C, Bat8
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5951 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34898469-34914052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34899381 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 44 (T44I)
Ref Sequence ENSEMBL: ENSMUSP00000109667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013931] [ENSMUST00000052778] [ENSMUST00000078061] [ENSMUST00000097342] [ENSMUST00000114033] [ENSMUST00000148431] [ENSMUST00000173093]
Predicted Effect probably benign
Transcript: ENSMUST00000013931
AA Change: T101I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000013931
Gene: ENSMUSG00000013787
AA Change: T101I

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 604 627 N/A INTRINSIC
ANK 737 766 2.52e-6 SMART
ANK 770 799 1.19e-2 SMART
ANK 803 833 4.71e-6 SMART
ANK 837 866 2.9e-6 SMART
ANK 870 899 1e0 SMART
ANK 903 932 1.53e-5 SMART
PreSET 976 1075 2.44e-40 SMART
SET 1091 1214 4.08e-46 SMART
PostSET 1217 1233 2.84e-1 SMART
low complexity region 1245 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052778
SMART Domains Protein: ENSMUSP00000057515
Gene: ENSMUSG00000049823

DomainStartEndE-ValueType
BTB 33 127 1.5e-19 SMART
low complexity region 138 149 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 186 204 N/A INTRINSIC
low complexity region 227 241 N/A INTRINSIC
low complexity region 297 327 N/A INTRINSIC
ZnF_C2H2 333 356 4.4e-2 SMART
ZnF_C2H2 359 381 2.27e-4 SMART
ZnF_C2H2 387 409 1.25e-1 SMART
ZnF_C2H2 415 438 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078061
AA Change: T44I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077208
Gene: ENSMUSG00000013787
AA Change: T44I

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
ANK 646 675 2.52e-6 SMART
ANK 679 708 1.19e-2 SMART
ANK 712 742 4.71e-6 SMART
ANK 746 775 2.9e-6 SMART
ANK 779 808 1e0 SMART
ANK 812 841 1.53e-5 SMART
PreSET 885 984 2.44e-40 SMART
SET 1000 1123 4.08e-46 SMART
PostSET 1126 1142 2.84e-1 SMART
low complexity region 1154 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097342
AA Change: T101I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094955
Gene: ENSMUSG00000013787
AA Change: T101I

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
ANK 703 732 2.52e-6 SMART
ANK 736 765 1.19e-2 SMART
ANK 769 799 4.71e-6 SMART
ANK 803 832 2.9e-6 SMART
ANK 836 865 1e0 SMART
ANK 869 898 1.53e-5 SMART
PreSET 942 1041 2.44e-40 SMART
SET 1057 1180 4.08e-46 SMART
PostSET 1183 1199 2.84e-1 SMART
low complexity region 1211 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114033
AA Change: T44I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109667
Gene: ENSMUSG00000013787
AA Change: T44I

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
ANK 680 709 2.52e-6 SMART
ANK 713 742 1.19e-2 SMART
ANK 746 776 4.71e-6 SMART
ANK 780 809 2.9e-6 SMART
ANK 813 842 1e0 SMART
ANK 846 875 1.53e-5 SMART
PreSET 919 1018 2.44e-40 SMART
SET 1034 1157 4.08e-46 SMART
PostSET 1160 1176 2.84e-1 SMART
low complexity region 1188 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146418
Predicted Effect probably benign
Transcript: ENSMUST00000148431
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173093
SMART Domains Protein: ENSMUSP00000133903
Gene: ENSMUSG00000049823

DomainStartEndE-ValueType
Pfam:BTB 23 68 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174880
Meta Mutation Damage Score 0.004 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E9.5-E12.5. Mutant embryos are developmentally delayed. Conditional deletion in germ cells results in infertility and arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Ehmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ehmt2 APN 17 34910815 missense probably damaging 1.00
IGL02398:Ehmt2 APN 17 34908479 missense probably damaging 1.00
IGL02878:Ehmt2 APN 17 34910767 missense probably damaging 1.00
IGL02928:Ehmt2 APN 17 34910822 missense probably damaging 1.00
IGL03117:Ehmt2 APN 17 34906811 missense possibly damaging 0.54
R0630:Ehmt2 UTSW 17 34899842 missense probably benign 0.02
R0778:Ehmt2 UTSW 17 34905418 missense probably damaging 0.99
R0909:Ehmt2 UTSW 17 34906504 missense possibly damaging 0.95
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1693:Ehmt2 UTSW 17 34906410 missense possibly damaging 0.88
R1855:Ehmt2 UTSW 17 34910776 missense probably damaging 1.00
R2212:Ehmt2 UTSW 17 34899365 missense probably benign
R2275:Ehmt2 UTSW 17 34910715 missense possibly damaging 0.95
R3761:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R3827:Ehmt2 UTSW 17 34906765 missense possibly damaging 0.95
R3915:Ehmt2 UTSW 17 34903467 missense probably damaging 0.99
R4303:Ehmt2 UTSW 17 34908748 missense possibly damaging 0.92
R4529:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R4651:Ehmt2 UTSW 17 34913814 missense probably damaging 1.00
R4825:Ehmt2 UTSW 17 34906964 missense probably benign
R5061:Ehmt2 UTSW 17 34899091 nonsense probably null
R5158:Ehmt2 UTSW 17 34911664 missense probably damaging 1.00
R5298:Ehmt2 UTSW 17 34899091 nonsense probably null
R5299:Ehmt2 UTSW 17 34899091 nonsense probably null
R5523:Ehmt2 UTSW 17 34899091 nonsense probably null
R5524:Ehmt2 UTSW 17 34899091 nonsense probably null
R5727:Ehmt2 UTSW 17 34906032 missense possibly damaging 0.75
R5755:Ehmt2 UTSW 17 34908238 missense probably benign 0.05
R5786:Ehmt2 UTSW 17 34910743 missense probably damaging 1.00
R6036:Ehmt2 UTSW 17 34899091 nonsense probably null
R6162:Ehmt2 UTSW 17 34899091 nonsense probably null
R6708:Ehmt2 UTSW 17 34899899 nonsense probably null
R6889:Ehmt2 UTSW 17 34912772 missense probably damaging 1.00
R6943:Ehmt2 UTSW 17 34911430 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTGCTGGAGAAGGA -3'
(R):5'- GCATGCAGAAAGCCCCTC -3'

Sequencing Primer
(F):5'- TGCTGGAGAAGGAGCCCC -3'
(R):5'- GTCTCTCACCCAGCACGATG -3'
Posted On2017-03-31