Incidental Mutation 'R5952:Ptprk'
ID470955
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28585675 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 69 (I69F)
Ref Sequence ENSEMBL: ENSMUSP00000151493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359] [ENSMUST00000220357]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166468
AA Change: I1140F

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: I1140F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: I1154F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218359
AA Change: I1128F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000220357
AA Change: I69F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220404
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATTTTGATGACGTGTGACTC -3'
(R):5'- TAAGCAGGCTTCTAAAATGGCATC -3'

Sequencing Primer
(F):5'- TGATGACGTGTGACTCAAAATAC -3'
(R):5'- AGGAAAGAGAGACAATTTCATATGAG -3'
Posted On2017-03-31