Incidental Mutation 'R0501:Insrr'
ID47096
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Nameinsulin receptor-related receptor
Synonyms
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R0501 (G1)
Quality Score187
Status Not validated
Chromosome3
Chromosomal Location87796951-87816101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87810684 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 871 (A871S)
Ref Sequence ENSEMBL: ENSMUSP00000103208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
Predicted Effect probably benign
Transcript: ENSMUST00000029711
AA Change: A871S

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: A871S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107582
AA Change: A871S

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: A871S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87813674 critical splice donor site probably null
IGL00801:Insrr APN 3 87813808 missense probably damaging 1.00
IGL01628:Insrr APN 3 87800792 nonsense probably null
IGL01755:Insrr APN 3 87814186 missense probably damaging 1.00
IGL02100:Insrr APN 3 87811620 missense probably damaging 1.00
IGL02261:Insrr APN 3 87800722 missense probably damaging 1.00
IGL02366:Insrr APN 3 87809909 missense possibly damaging 0.91
IGL02387:Insrr APN 3 87813127 missense probably damaging 1.00
IGL02478:Insrr APN 3 87809412 missense probably benign 0.14
IGL02550:Insrr APN 3 87804498 missense probably damaging 1.00
IGL02555:Insrr APN 3 87813817 missense probably damaging 0.99
IGL02673:Insrr APN 3 87813061 missense possibly damaging 0.95
IGL02724:Insrr APN 3 87809572 missense probably benign 0.31
IGL02798:Insrr APN 3 87810517 missense probably damaging 1.00
IGL02969:Insrr APN 3 87814191 nonsense probably null
IGL03073:Insrr APN 3 87809938 splice site probably benign
IGL03178:Insrr APN 3 87802541 intron probably null
IGL03389:Insrr APN 3 87808731 missense probably damaging 1.00
IGL03399:Insrr APN 3 87809331 missense probably null 0.99
IGL02799:Insrr UTSW 3 87813581 missense probably damaging 1.00
R0011:Insrr UTSW 3 87809616 missense possibly damaging 0.86
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0357:Insrr UTSW 3 87808646 intron probably null
R0504:Insrr UTSW 3 87813156 missense possibly damaging 0.69
R0522:Insrr UTSW 3 87800872 missense probably damaging 1.00
R0555:Insrr UTSW 3 87814437 splice site probably benign
R0558:Insrr UTSW 3 87810981 missense possibly damaging 0.77
R0599:Insrr UTSW 3 87813133 missense probably damaging 0.97
R1312:Insrr UTSW 3 87800490 missense probably damaging 1.00
R1694:Insrr UTSW 3 87804062 missense probably benign
R1785:Insrr UTSW 3 87810572 splice site probably null
R1786:Insrr UTSW 3 87810572 splice site probably null
R1892:Insrr UTSW 3 87813877 missense probably damaging 1.00
R1950:Insrr UTSW 3 87814513 missense probably damaging 1.00
R2080:Insrr UTSW 3 87814291 missense possibly damaging 0.79
R2094:Insrr UTSW 3 87803181 missense probably damaging 1.00
R2130:Insrr UTSW 3 87810572 splice site probably null
R2131:Insrr UTSW 3 87810572 splice site probably null
R2133:Insrr UTSW 3 87810572 splice site probably null
R2220:Insrr UTSW 3 87809418 missense probably damaging 1.00
R2259:Insrr UTSW 3 87800452 missense probably damaging 1.00
R2404:Insrr UTSW 3 87802667 missense possibly damaging 0.71
R4027:Insrr UTSW 3 87809599 missense probably benign
R4042:Insrr UTSW 3 87813827 missense probably damaging 1.00
R4510:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4511:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4571:Insrr UTSW 3 87800887 missense probably benign
R4870:Insrr UTSW 3 87811604 missense probably damaging 1.00
R5057:Insrr UTSW 3 87815265 missense probably benign 0.00
R5393:Insrr UTSW 3 87810700 intron probably null
R5685:Insrr UTSW 3 87800496 intron probably null
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6047:Insrr UTSW 3 87804176 missense probably damaging 1.00
R6276:Insrr UTSW 3 87800519 nonsense probably null
R6298:Insrr UTSW 3 87812965 missense probably damaging 1.00
R6726:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6727:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6728:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6796:Insrr UTSW 3 87813566 missense probably damaging 1.00
R7041:Insrr UTSW 3 87815244 missense probably damaging 1.00
R7169:Insrr UTSW 3 87808594 missense probably benign 0.15
R7270:Insrr UTSW 3 87803133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTGGCTTGAACCACCTGAC -3'
(R):5'- GGATATAAGCTGCTCCTCAGGCAAC -3'

Sequencing Primer
(F):5'- ACCTGACCCCAATGGGC -3'
(R):5'- AACGCTGGAGCATGGTC -3'
Posted On2013-06-12