Incidental Mutation 'R5952:Btn2a2'
ID470969
Institutional Source Beutler Lab
Gene Symbol Btn2a2
Ensembl Gene ENSMUSG00000053216
Gene Namebutyrophilin, subfamily 2, member A2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23477676-23488857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23482808 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 209 (I209N)
Ref Sequence ENSEMBL: ENSMUSP00000153680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041541] [ENSMUST00000110432] [ENSMUST00000110433] [ENSMUST00000223877]
Predicted Effect probably benign
Transcript: ENSMUST00000041541
AA Change: I209N

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048251
Gene: ENSMUSG00000053216
AA Change: I209N

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 3.3e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110432
AA Change: I209N

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106062
Gene: ENSMUSG00000053216
AA Change: I209N

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Blast:IG_like 151 211 1e-29 BLAST
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110433
AA Change: I209N

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106063
Gene: ENSMUSG00000053216
AA Change: I209N

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 1.2e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223877
AA Change: I209N

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. This gene is a member of the BTN2 subfamily of genes, which encode proteins belonging to the butyrophilin protein family. The gene is located in a cluster on chromosome 6, consisting of seven genes belonging to the expanding B7/butyrophilin-like group, a subset of the immunoglobulin gene superfamily. The encoded protein is a type I receptor glycoprotein involved in lipid, fatty-acid and sterol metabolism. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Btn2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Btn2a2 APN 13 23478576 missense probably damaging 1.00
IGL00740:Btn2a2 APN 13 23478485 missense probably benign
IGL02053:Btn2a2 APN 13 23478820 missense probably damaging 1.00
IGL02720:Btn2a2 APN 13 23480467 missense probably benign 0.15
IGL02738:Btn2a2 APN 13 23478806 nonsense probably null
IGL03010:Btn2a2 APN 13 23486205 nonsense probably null
IGL03221:Btn2a2 APN 13 23478449 missense probably damaging 1.00
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0597:Btn2a2 UTSW 13 23486410 missense probably benign 0.12
R0749:Btn2a2 UTSW 13 23478398 makesense probably null
R1209:Btn2a2 UTSW 13 23480566 critical splice donor site probably null
R1283:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R1718:Btn2a2 UTSW 13 23481936 missense probably benign 0.01
R2925:Btn2a2 UTSW 13 23481814 missense probably damaging 1.00
R3824:Btn2a2 UTSW 13 23480465 missense probably benign 0.02
R5281:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R5356:Btn2a2 UTSW 13 23482875 missense probably benign 0.02
R5482:Btn2a2 UTSW 13 23486387 missense probably benign 0.03
R5535:Btn2a2 UTSW 13 23478275 missense probably benign 0.14
R5629:Btn2a2 UTSW 13 23481960 splice site probably null
R5930:Btn2a2 UTSW 13 23486228 missense probably damaging 0.96
R6006:Btn2a2 UTSW 13 23486363 missense probably damaging 1.00
R6196:Btn2a2 UTSW 13 23487845 missense possibly damaging 0.74
R6373:Btn2a2 UTSW 13 23481829 missense probably benign 0.00
R6533:Btn2a2 UTSW 13 23481781 nonsense probably null
R6891:Btn2a2 UTSW 13 23482844 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCAGAGCCAAAGATCCTTC -3'
(R):5'- TAGCTGAGCCCTGGTCTTTC -3'

Sequencing Primer
(F):5'- GAGCCAAAGATCCTTCCCCAG -3'
(R):5'- GCTCTGAGCCACTTATTAAAATGAAG -3'
Posted On2017-03-31