Incidental Mutation 'R5954:Knstrn'
ID471032
Institutional Source Beutler Lab
Gene Symbol Knstrn
Ensembl Gene ENSMUSG00000027331
Gene Namekinetochore-localized astrin/SPAG5 binding
Synonyms1700025D04Rik, D2Ertd750e
MMRRC Submission 044143-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5954 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118814003-118853957 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 118830955 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028803] [ENSMUST00000110842] [ENSMUST00000123104] [ENSMUST00000134661] [ENSMUST00000148877] [ENSMUST00000176463]
Predicted Effect probably benign
Transcript: ENSMUST00000028803
SMART Domains Protein: ENSMUSP00000028803
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 118 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110842
SMART Domains Protein: ENSMUSP00000106466
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 91 132 N/A INTRINSIC
coiled coil region 168 210 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123104
SMART Domains Protein: ENSMUSP00000135422
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 104 145 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126045
AA Change: Q213R
SMART Domains Protein: ENSMUSP00000122844
Gene: ENSMUSG00000027331
AA Change: Q213R

DomainStartEndE-ValueType
coiled coil region 110 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133534
Predicted Effect probably benign
Transcript: ENSMUST00000134579
Predicted Effect probably benign
Transcript: ENSMUST00000134661
SMART Domains Protein: ENSMUSP00000115860
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
coiled coil region 169 210 N/A INTRINSIC
coiled coil region 246 288 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148877
Predicted Effect probably benign
Transcript: ENSMUST00000176463
SMART Domains Protein: ENSMUSP00000135549
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 49 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177103
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display reduced fertility, decreased testis size, oligozoospermia, and defects in early spermatogenesis associated with abnormal spermatogonia proliferation and increased testis apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,416 I944T probably benign Het
Ank2 T C 3: 126,997,861 T823A probably benign Het
Ankrd42 C G 7: 92,623,967 probably null Het
Anks4b T A 7: 120,182,173 N142K possibly damaging Het
Armc5 A G 7: 128,242,272 E484G probably benign Het
B4galnt3 A G 6: 120,225,188 F118L possibly damaging Het
Bbs12 C T 3: 37,320,002 L200F possibly damaging Het
Cacna1h A G 17: 25,383,201 F1555S probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Chd6 A C 2: 160,965,827 H1822Q probably benign Het
Chdh C T 14: 30,031,181 R16C possibly damaging Het
Cnga1 T C 5: 72,604,878 D431G probably damaging Het
Dock8 G A 19: 25,171,619 R1487Q probably damaging Het
Farp1 T A 14: 121,222,667 V116D probably damaging Het
Fbxo24 T A 5: 137,619,681 T274S probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gatad2b T C 3: 90,351,441 L257P probably damaging Het
Gm20402 C T 3: 52,268,890 P30L probably damaging Het
Gm7932 C T 6: 48,862,859 noncoding transcript Het
Gpatch8 A T 11: 102,480,941 D590E unknown Het
Herc1 T G 9: 66,451,492 probably benign Het
Hsd3b2 T A 3: 98,711,559 I357F probably benign Het
Ipo5 A G 14: 120,919,984 Y78C probably damaging Het
Itga8 C A 2: 12,132,486 A23S probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat2a A G 11: 100,708,898 V451A possibly damaging Het
Med23 A G 10: 24,870,483 probably benign Het
Mefv A G 16: 3,715,715 Y231H probably benign Het
Olfr1425 A T 19: 12,074,083 I183N possibly damaging Het
Olfr1507 T A 14: 52,490,167 I266F probably benign Het
Olfr494 T A 7: 108,367,601 I37N probably damaging Het
Olfr935 A G 9: 38,995,415 S7P probably damaging Het
Pak7 G T 2: 136,116,463 T235K probably benign Het
Plppr3 G T 10: 79,866,126 P294Q probably benign Het
Prepl A G 17: 85,064,649 F725L probably benign Het
Ptchd3 A T 11: 121,836,587 probably benign Het
Rprd2 T C 3: 95,764,863 E1076G probably damaging Het
Sarm1 C A 11: 78,490,602 E352* probably null Het
Sccpdh T A 1: 179,680,588 H14Q probably benign Het
Senp7 A G 16: 56,169,871 I661V probably benign Het
Sept3 T C 15: 82,290,427 F140L probably damaging Het
Spag6 G T 2: 18,710,606 Q65H probably damaging Het
Tnni3 C T 7: 4,519,540 R137H probably damaging Het
Trank1 A G 9: 111,365,133 S742G probably benign Het
Ucn3 T C 13: 3,941,413 I80V probably benign Het
Ulk2 A T 11: 61,803,796 probably benign Het
Uncx C T 5: 139,547,629 S483L probably benign Het
Vps39 A G 2: 120,324,662 V550A probably damaging Het
Zfp697 C A 3: 98,428,593 T558K probably damaging Het
Zfp790 G T 7: 29,829,504 G538V probably damaging Het
Other mutations in Knstrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02370:Knstrn APN 2 118823788 critical splice donor site probably null
R0529:Knstrn UTSW 2 118830980 intron probably benign
R2202:Knstrn UTSW 2 118830975 unclassified probably null
R2203:Knstrn UTSW 2 118830975 unclassified probably null
R2204:Knstrn UTSW 2 118830975 unclassified probably null
R2430:Knstrn UTSW 2 118834103 utr 3 prime probably benign
R4672:Knstrn UTSW 2 118834031 missense probably damaging 0.98
R4672:Knstrn UTSW 2 118834032 missense possibly damaging 0.93
R5554:Knstrn UTSW 2 118833963 intron probably benign
R6695:Knstrn UTSW 2 118814242 missense probably damaging 0.99
R6981:Knstrn UTSW 2 118834094 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CATTGCTGAGAACTCCATAATGC -3'
(R):5'- ATGGGCACTGCTCTTAGGAAC -3'

Sequencing Primer
(F):5'- AACTCCATAATGCCAAGCCTGTTTG -3'
(R):5'- GGCACTGCTCTTAGGAACTGTTTC -3'
Posted On2017-03-31