Incidental Mutation 'R0501:Wdtc1'
ID47105
Institutional Source Beutler Lab
Gene Symbol Wdtc1
Ensembl Gene ENSMUSG00000037622
Gene NameWD and tetratricopeptide repeats 1
Synonymsadipose, LOC230796, adp
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133292459-133353481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133308840 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 130 (F130L)
Ref Sequence ENSEMBL: ENSMUSP00000101526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043305] [ENSMUST00000105906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043305
AA Change: F130L

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040647
Gene: ENSMUSG00000037622
AA Change: F130L

DomainStartEndE-ValueType
WD40 36 75 4.58e-8 SMART
WD40 79 120 1.24e-4 SMART
WD40 123 163 2.58e-1 SMART
WD40 170 213 4.42e1 SMART
Pfam:TPR_11 362 429 1.1e-15 PFAM
Pfam:TPR_2 432 457 1.1e-3 PFAM
low complexity region 488 499 N/A INTRINSIC
WD40 523 566 7.16e-1 SMART
WD40 569 608 1.55e-5 SMART
low complexity region 655 670 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105906
AA Change: F130L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101526
Gene: ENSMUSG00000037622
AA Change: F130L

DomainStartEndE-ValueType
WD40 36 75 4.58e-8 SMART
WD40 79 120 1.24e-4 SMART
WD40 123 163 2.58e-1 SMART
WD40 170 213 4.42e1 SMART
Blast:WD40 261 296 5e-12 BLAST
Pfam:TPR_11 361 429 2.9e-16 PFAM
Pfam:TPR_2 432 457 1.4e-3 PFAM
low complexity region 488 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145426
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for a gene trapped allele are obese and insulin resistant with significantly elevated plasma insulin and leptin levels. Although a number of adult homozygotes are also described as obese, the majority of homozygotes die in utero thus precluding statistically significant analyses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Wdtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Wdtc1 APN 4 133295232 missense probably damaging 1.00
IGL02005:Wdtc1 APN 4 133308914 missense probably benign 0.14
IGL02078:Wdtc1 APN 4 133305960 missense probably damaging 1.00
IGL02146:Wdtc1 APN 4 133301765 missense probably benign 0.00
IGL02724:Wdtc1 APN 4 133297478 missense possibly damaging 0.78
IGL03196:Wdtc1 APN 4 133295337 missense probably damaging 1.00
pear UTSW 4 133294391 splice site probably null
R0448:Wdtc1 UTSW 4 133297500 missense probably damaging 1.00
R0743:Wdtc1 UTSW 4 133300661 missense probably damaging 0.99
R1170:Wdtc1 UTSW 4 133297546 missense probably damaging 0.99
R1439:Wdtc1 UTSW 4 133301807 missense probably benign
R1456:Wdtc1 UTSW 4 133297428 missense possibly damaging 0.83
R1833:Wdtc1 UTSW 4 133308742 splice site probably benign
R4506:Wdtc1 UTSW 4 133308819 missense probably damaging 1.00
R4687:Wdtc1 UTSW 4 133296431 missense probably damaging 1.00
R4739:Wdtc1 UTSW 4 133301799 missense possibly damaging 0.68
R4967:Wdtc1 UTSW 4 133294343 missense probably damaging 0.99
R5032:Wdtc1 UTSW 4 133308851 missense possibly damaging 0.89
R5193:Wdtc1 UTSW 4 133294367 nonsense probably null
R5448:Wdtc1 UTSW 4 133294297 missense probably benign
R5593:Wdtc1 UTSW 4 133294391 splice site probably null
R5890:Wdtc1 UTSW 4 133294362 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCCATCCGTGTCTGAAGGGAAC -3'
(R):5'- CACGAAGTGCAGATCCTGACTGAAC -3'

Sequencing Primer
(F):5'- tgaagggaacagggcaaac -3'
(R):5'- AGATCCTGACTGAACTTCTGTG -3'
Posted On2013-06-12