Incidental Mutation 'R5954:Zfp790'
ID471050
Institutional Source Beutler Lab
Gene Symbol Zfp790
Ensembl Gene ENSMUSG00000011427
Gene Namezinc finger protein 790
Synonyms6330581L23Rik
MMRRC Submission 044143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5954 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29816114-29831005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 29829504 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 538 (G538V)
Ref Sequence ENSEMBL: ENSMUSP00000136932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032796] [ENSMUST00000108223] [ENSMUST00000178162]
Predicted Effect probably damaging
Transcript: ENSMUST00000032796
AA Change: G538V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032796
Gene: ENSMUSG00000011427
AA Change: G538V

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
Pfam:zf-C2H2_6 391 403 2.4e-1 PFAM
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108223
SMART Domains Protein: ENSMUSP00000103858
Gene: ENSMUSG00000050855

DomainStartEndE-ValueType
KRAB 6 67 2.42e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178162
AA Change: G538V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136932
Gene: ENSMUSG00000011427
AA Change: G538V

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Meta Mutation Damage Score 0.448 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,416 I944T probably benign Het
Ank2 T C 3: 126,997,861 T823A probably benign Het
Ankrd42 C G 7: 92,623,967 probably null Het
Anks4b T A 7: 120,182,173 N142K possibly damaging Het
Armc5 A G 7: 128,242,272 E484G probably benign Het
B4galnt3 A G 6: 120,225,188 F118L possibly damaging Het
Bbs12 C T 3: 37,320,002 L200F possibly damaging Het
Cacna1h A G 17: 25,383,201 F1555S probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Chd6 A C 2: 160,965,827 H1822Q probably benign Het
Chdh C T 14: 30,031,181 R16C possibly damaging Het
Cnga1 T C 5: 72,604,878 D431G probably damaging Het
Dock8 G A 19: 25,171,619 R1487Q probably damaging Het
Farp1 T A 14: 121,222,667 V116D probably damaging Het
Fbxo24 T A 5: 137,619,681 T274S probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gatad2b T C 3: 90,351,441 L257P probably damaging Het
Gm20402 C T 3: 52,268,890 P30L probably damaging Het
Gm7932 C T 6: 48,862,859 noncoding transcript Het
Gpatch8 A T 11: 102,480,941 D590E unknown Het
Herc1 T G 9: 66,451,492 probably benign Het
Hsd3b2 T A 3: 98,711,559 I357F probably benign Het
Ipo5 A G 14: 120,919,984 Y78C probably damaging Het
Itga8 C A 2: 12,132,486 A23S probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat2a A G 11: 100,708,898 V451A possibly damaging Het
Knstrn A G 2: 118,830,955 probably benign Het
Med23 A G 10: 24,870,483 probably benign Het
Mefv A G 16: 3,715,715 Y231H probably benign Het
Olfr1425 A T 19: 12,074,083 I183N possibly damaging Het
Olfr1507 T A 14: 52,490,167 I266F probably benign Het
Olfr494 T A 7: 108,367,601 I37N probably damaging Het
Olfr935 A G 9: 38,995,415 S7P probably damaging Het
Pak7 G T 2: 136,116,463 T235K probably benign Het
Plppr3 G T 10: 79,866,126 P294Q probably benign Het
Prepl A G 17: 85,064,649 F725L probably benign Het
Ptchd3 A T 11: 121,836,587 probably benign Het
Rprd2 T C 3: 95,764,863 E1076G probably damaging Het
Sarm1 C A 11: 78,490,602 E352* probably null Het
Sccpdh T A 1: 179,680,588 H14Q probably benign Het
Senp7 A G 16: 56,169,871 I661V probably benign Het
Sept3 T C 15: 82,290,427 F140L probably damaging Het
Spag6 G T 2: 18,710,606 Q65H probably damaging Het
Tnni3 C T 7: 4,519,540 R137H probably damaging Het
Trank1 A G 9: 111,365,133 S742G probably benign Het
Ucn3 T C 13: 3,941,413 I80V probably benign Het
Ulk2 A T 11: 61,803,796 probably benign Het
Uncx C T 5: 139,547,629 S483L probably benign Het
Vps39 A G 2: 120,324,662 V550A probably damaging Het
Zfp697 C A 3: 98,428,593 T558K probably damaging Het
Other mutations in Zfp790
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp790 APN 7 29828563 missense probably benign 0.32
IGL00979:Zfp790 APN 7 29829609 missense probably benign 0.00
IGL02286:Zfp790 APN 7 29829735 missense possibly damaging 0.53
IGL03136:Zfp790 APN 7 29829895 nonsense probably null
R0021:Zfp790 UTSW 7 29825688 unclassified probably benign
R0077:Zfp790 UTSW 7 29824875 missense probably damaging 0.98
R1477:Zfp790 UTSW 7 29823100 start gained probably benign
R1572:Zfp790 UTSW 7 29828139 missense probably benign 0.33
R2015:Zfp790 UTSW 7 29828861 missense probably benign 0.29
R4941:Zfp790 UTSW 7 29829491 missense possibly damaging 0.83
R5019:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5159:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5160:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5722:Zfp790 UTSW 7 29830089 nonsense probably null
R6025:Zfp790 UTSW 7 29829545 missense possibly damaging 0.71
R6312:Zfp790 UTSW 7 29828222 missense probably damaging 1.00
R7392:Zfp790 UTSW 7 29828625 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCGCTCCATCGTTAGTAGTC -3'
(R):5'- CTTAGCAGCCTGGAGTTGAGTC -3'

Sequencing Primer
(F):5'- TTAAATGTAAGGACTGTGAAAAGGCC -3'
(R):5'- AGTCCGCTCTGGGTCATGAAG -3'
Posted On2017-03-31