Incidental Mutation 'R5954:Ankrd42'
ID471051
Institutional Source Beutler Lab
Gene Symbol Ankrd42
Ensembl Gene ENSMUSG00000041343
Gene Nameankyrin repeat domain 42
Synonyms4933417L02Rik, Ikbn
MMRRC Submission 044143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5954 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location92581723-92637142 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to G at 92623967 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056106] [ENSMUST00000118157] [ENSMUST00000126305] [ENSMUST00000138267] [ENSMUST00000138267] [ENSMUST00000207131] [ENSMUST00000207131] [ENSMUST00000207151]
Predicted Effect probably null
Transcript: ENSMUST00000056106
SMART Domains Protein: ENSMUSP00000061208
Gene: ENSMUSG00000041343

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118157
SMART Domains Protein: ENSMUSP00000113767
Gene: ENSMUSG00000041343

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126305
SMART Domains Protein: ENSMUSP00000123315
Gene: ENSMUSG00000041343

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 2.92e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138267
Predicted Effect probably null
Transcript: ENSMUST00000138267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142971
Predicted Effect probably null
Transcript: ENSMUST00000207131
Predicted Effect probably null
Transcript: ENSMUST00000207131
Predicted Effect probably benign
Transcript: ENSMUST00000207151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207971
Meta Mutation Damage Score 0.584 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,416 I944T probably benign Het
Ank2 T C 3: 126,997,861 T823A probably benign Het
Anks4b T A 7: 120,182,173 N142K possibly damaging Het
Armc5 A G 7: 128,242,272 E484G probably benign Het
B4galnt3 A G 6: 120,225,188 F118L possibly damaging Het
Bbs12 C T 3: 37,320,002 L200F possibly damaging Het
Cacna1h A G 17: 25,383,201 F1555S probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Chd6 A C 2: 160,965,827 H1822Q probably benign Het
Chdh C T 14: 30,031,181 R16C possibly damaging Het
Cnga1 T C 5: 72,604,878 D431G probably damaging Het
Dock8 G A 19: 25,171,619 R1487Q probably damaging Het
Farp1 T A 14: 121,222,667 V116D probably damaging Het
Fbxo24 T A 5: 137,619,681 T274S probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gatad2b T C 3: 90,351,441 L257P probably damaging Het
Gm20402 C T 3: 52,268,890 P30L probably damaging Het
Gm7932 C T 6: 48,862,859 noncoding transcript Het
Gpatch8 A T 11: 102,480,941 D590E unknown Het
Herc1 T G 9: 66,451,492 probably benign Het
Hsd3b2 T A 3: 98,711,559 I357F probably benign Het
Ipo5 A G 14: 120,919,984 Y78C probably damaging Het
Itga8 C A 2: 12,132,486 A23S probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat2a A G 11: 100,708,898 V451A possibly damaging Het
Knstrn A G 2: 118,830,955 probably benign Het
Med23 A G 10: 24,870,483 probably benign Het
Mefv A G 16: 3,715,715 Y231H probably benign Het
Olfr1425 A T 19: 12,074,083 I183N possibly damaging Het
Olfr1507 T A 14: 52,490,167 I266F probably benign Het
Olfr494 T A 7: 108,367,601 I37N probably damaging Het
Olfr935 A G 9: 38,995,415 S7P probably damaging Het
Pak7 G T 2: 136,116,463 T235K probably benign Het
Plppr3 G T 10: 79,866,126 P294Q probably benign Het
Prepl A G 17: 85,064,649 F725L probably benign Het
Ptchd3 A T 11: 121,836,587 probably benign Het
Rprd2 T C 3: 95,764,863 E1076G probably damaging Het
Sarm1 C A 11: 78,490,602 E352* probably null Het
Sccpdh T A 1: 179,680,588 H14Q probably benign Het
Senp7 A G 16: 56,169,871 I661V probably benign Het
Sept3 T C 15: 82,290,427 F140L probably damaging Het
Spag6 G T 2: 18,710,606 Q65H probably damaging Het
Tnni3 C T 7: 4,519,540 R137H probably damaging Het
Trank1 A G 9: 111,365,133 S742G probably benign Het
Ucn3 T C 13: 3,941,413 I80V probably benign Het
Ulk2 A T 11: 61,803,796 probably benign Het
Uncx C T 5: 139,547,629 S483L probably benign Het
Vps39 A G 2: 120,324,662 V550A probably damaging Het
Zfp697 C A 3: 98,428,593 T558K probably damaging Het
Zfp790 G T 7: 29,829,504 G538V probably damaging Het
Other mutations in Ankrd42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ankrd42 APN 7 92584454 utr 3 prime probably benign
IGL01151:Ankrd42 APN 7 92605200 unclassified probably benign
IGL01444:Ankrd42 APN 7 92610585 missense probably damaging 0.96
IGL01933:Ankrd42 APN 7 92605285 missense probably benign
IGL03195:Ankrd42 APN 7 92591858 missense probably benign 0.33
IGL03397:Ankrd42 APN 7 92619554 missense probably damaging 1.00
R0128:Ankrd42 UTSW 7 92591859 nonsense probably null
R0278:Ankrd42 UTSW 7 92631657 missense possibly damaging 0.82
R0839:Ankrd42 UTSW 7 92612772 missense possibly damaging 0.92
R1227:Ankrd42 UTSW 7 92605300 missense possibly damaging 0.53
R1603:Ankrd42 UTSW 7 92619691 intron probably benign
R2281:Ankrd42 UTSW 7 92625773 nonsense probably null
R2299:Ankrd42 UTSW 7 92590254 missense probably benign 0.33
R2324:Ankrd42 UTSW 7 92623978 missense probably damaging 0.98
R2874:Ankrd42 UTSW 7 92605358 missense possibly damaging 0.71
R3940:Ankrd42 UTSW 7 92591788 intron probably null
R4998:Ankrd42 UTSW 7 92624074 missense possibly damaging 0.71
R5579:Ankrd42 UTSW 7 92590182 missense possibly damaging 0.96
R6140:Ankrd42 UTSW 7 92591828 splice site probably null
R6924:Ankrd42 UTSW 7 92582016 unclassified probably benign
R6944:Ankrd42 UTSW 7 92619547 critical splice donor site probably null
R7096:Ankrd42 UTSW 7 92591832 nonsense probably null
R7101:Ankrd42 UTSW 7 92631544 missense possibly damaging 0.53
R7155:Ankrd42 UTSW 7 92591933 missense possibly damaging 0.72
R7410:Ankrd42 UTSW 7 92610554 missense possibly damaging 0.93
X0065:Ankrd42 UTSW 7 92610555 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGTTCATTGTGGGGAAAGGC -3'
(R):5'- CCAATTAAGGTCCCACAGGC -3'

Sequencing Primer
(F):5'- AAGGCAAGGGGAGATTTTTCTC -3'
(R):5'- CACAGGCAGTGTTATAGAAGACTTG -3'
Posted On2017-03-31