Incidental Mutation 'R5954:Ulk2'
ID471060
Institutional Source Beutler Lab
Gene Symbol Ulk2
Ensembl Gene ENSMUSG00000004798
Gene Nameunc-51 like kinase 2
SynonymsUnc51.2, A830085I22Rik
MMRRC Submission 044143-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R5954 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61775649-61855073 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 61803796 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004920]
Predicted Effect probably benign
Transcript: ENSMUST00000004920
SMART Domains Protein: ENSMUSP00000004920
Gene: ENSMUSG00000004798

DomainStartEndE-ValueType
S_TKc 9 271 1.1e-93 SMART
low complexity region 274 309 N/A INTRINSIC
Blast:S_TKc 310 413 9e-28 BLAST
Blast:S_TKc 433 738 1e-29 BLAST
low complexity region 751 766 N/A INTRINSIC
low complexity region 771 791 N/A INTRINSIC
Pfam:DUF3543 821 1032 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157049
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased anxiety-like response in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,416 I944T probably benign Het
Ank2 T C 3: 126,997,861 T823A probably benign Het
Ankrd42 C G 7: 92,623,967 probably null Het
Anks4b T A 7: 120,182,173 N142K possibly damaging Het
Armc5 A G 7: 128,242,272 E484G probably benign Het
B4galnt3 A G 6: 120,225,188 F118L possibly damaging Het
Bbs12 C T 3: 37,320,002 L200F possibly damaging Het
Cacna1h A G 17: 25,383,201 F1555S probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Chd6 A C 2: 160,965,827 H1822Q probably benign Het
Chdh C T 14: 30,031,181 R16C possibly damaging Het
Cnga1 T C 5: 72,604,878 D431G probably damaging Het
Dock8 G A 19: 25,171,619 R1487Q probably damaging Het
Farp1 T A 14: 121,222,667 V116D probably damaging Het
Fbxo24 T A 5: 137,619,681 T274S probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gatad2b T C 3: 90,351,441 L257P probably damaging Het
Gm20402 C T 3: 52,268,890 P30L probably damaging Het
Gm7932 C T 6: 48,862,859 noncoding transcript Het
Gpatch8 A T 11: 102,480,941 D590E unknown Het
Herc1 T G 9: 66,451,492 probably benign Het
Hsd3b2 T A 3: 98,711,559 I357F probably benign Het
Ipo5 A G 14: 120,919,984 Y78C probably damaging Het
Itga8 C A 2: 12,132,486 A23S probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat2a A G 11: 100,708,898 V451A possibly damaging Het
Knstrn A G 2: 118,830,955 probably benign Het
Med23 A G 10: 24,870,483 probably benign Het
Mefv A G 16: 3,715,715 Y231H probably benign Het
Olfr1425 A T 19: 12,074,083 I183N possibly damaging Het
Olfr1507 T A 14: 52,490,167 I266F probably benign Het
Olfr494 T A 7: 108,367,601 I37N probably damaging Het
Olfr935 A G 9: 38,995,415 S7P probably damaging Het
Pak7 G T 2: 136,116,463 T235K probably benign Het
Plppr3 G T 10: 79,866,126 P294Q probably benign Het
Prepl A G 17: 85,064,649 F725L probably benign Het
Ptchd3 A T 11: 121,836,587 probably benign Het
Rprd2 T C 3: 95,764,863 E1076G probably damaging Het
Sarm1 C A 11: 78,490,602 E352* probably null Het
Sccpdh T A 1: 179,680,588 H14Q probably benign Het
Senp7 A G 16: 56,169,871 I661V probably benign Het
Sept3 T C 15: 82,290,427 F140L probably damaging Het
Spag6 G T 2: 18,710,606 Q65H probably damaging Het
Tnni3 C T 7: 4,519,540 R137H probably damaging Het
Trank1 A G 9: 111,365,133 S742G probably benign Het
Ucn3 T C 13: 3,941,413 I80V probably benign Het
Uncx C T 5: 139,547,629 S483L probably benign Het
Vps39 A G 2: 120,324,662 V550A probably damaging Het
Zfp697 C A 3: 98,428,593 T558K probably damaging Het
Zfp790 G T 7: 29,829,504 G538V probably damaging Het
Other mutations in Ulk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Ulk2 APN 11 61791436 nonsense probably null
IGL02044:Ulk2 APN 11 61781639 missense probably damaging 1.00
IGL02185:Ulk2 APN 11 61782060 missense probably damaging 1.00
IGL03036:Ulk2 APN 11 61834834 missense probably damaging 1.00
R0207:Ulk2 UTSW 11 61777785 missense probably benign 0.42
R0362:Ulk2 UTSW 11 61787586 missense probably benign
R0657:Ulk2 UTSW 11 61808054 splice site probably benign
R1076:Ulk2 UTSW 11 61819309 missense probably damaging 1.00
R1144:Ulk2 UTSW 11 61800060 missense possibly damaging 0.80
R1573:Ulk2 UTSW 11 61779755 missense probably damaging 1.00
R1583:Ulk2 UTSW 11 61783545 missense possibly damaging 0.95
R1619:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R1757:Ulk2 UTSW 11 61841339 splice site probably benign
R1845:Ulk2 UTSW 11 61812738 missense probably benign 0.04
R1883:Ulk2 UTSW 11 61830612 missense probably damaging 1.00
R1966:Ulk2 UTSW 11 61819471 splice site probably null
R2177:Ulk2 UTSW 11 61791509 missense probably benign 0.01
R2416:Ulk2 UTSW 11 61782039 missense probably damaging 1.00
R2509:Ulk2 UTSW 11 61787514 missense probably benign 0.00
R2847:Ulk2 UTSW 11 61824729 critical splice acceptor site probably null
R4736:Ulk2 UTSW 11 61833435 missense probably damaging 1.00
R4997:Ulk2 UTSW 11 61799156 missense probably benign 0.00
R5081:Ulk2 UTSW 11 61803662 missense probably damaging 1.00
R5190:Ulk2 UTSW 11 61781711 missense probably benign
R5346:Ulk2 UTSW 11 61834914 missense probably damaging 1.00
R5348:Ulk2 UTSW 11 61783613 missense probably benign
R5520:Ulk2 UTSW 11 61808144 missense probably damaging 1.00
R6153:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R6223:Ulk2 UTSW 11 61787504 nonsense probably null
R7204:Ulk2 UTSW 11 61783631 missense probably benign 0.11
R7205:Ulk2 UTSW 11 61834831 missense possibly damaging 0.84
R7259:Ulk2 UTSW 11 61782083 missense probably damaging 1.00
R7353:Ulk2 UTSW 11 61819348 missense probably damaging 1.00
X0028:Ulk2 UTSW 11 61799568 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAATTCTCCTCACCCAAAGG -3'
(R):5'- TGAGCTCTGAAAGGATCACCAG -3'

Sequencing Primer
(F):5'- GGGATGGTGAGTAAGGCCTG -3'
(R):5'- GTCCTGGAACTCACTATGTAGAC -3'
Posted On2017-03-31