Incidental Mutation 'R5954:Chdh'
ID471068
Institutional Source Beutler Lab
Gene Symbol Chdh
Ensembl Gene ENSMUSG00000015970
Gene Namecholine dehydrogenase
SynonymsD630034H06Rik
MMRRC Submission 044143-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5954 (G1)
Quality Score163
Status Validated
Chromosome14
Chromosomal Location30009023-30040527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30031181 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 16 (R16C)
Ref Sequence ENSEMBL: ENSMUSP00000112916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067620] [ENSMUST00000118917]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067620
AA Change: R16C

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970
AA Change: R16C

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118917
AA Change: R16C

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112916
Gene: ENSMUSG00000015970
AA Change: R16C

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 44 109 1.9e-8 PFAM
Pfam:GMC_oxred_C 431 569 5.9e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225370
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a choline dehydrogenase that localizes to the mitochondrion. Variations in this gene can affect susceptibility to choline deficiency. A few transcript variants have been found for this gene, but the full-length nature of only one has been characterized to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous male mutants show reduced fertility due to reduced sperm motility caused by abnormal mitochondrial function and structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,416 I944T probably benign Het
Ank2 T C 3: 126,997,861 T823A probably benign Het
Ankrd42 C G 7: 92,623,967 probably null Het
Anks4b T A 7: 120,182,173 N142K possibly damaging Het
Armc5 A G 7: 128,242,272 E484G probably benign Het
B4galnt3 A G 6: 120,225,188 F118L possibly damaging Het
Bbs12 C T 3: 37,320,002 L200F possibly damaging Het
Cacna1h A G 17: 25,383,201 F1555S probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Chd6 A C 2: 160,965,827 H1822Q probably benign Het
Cnga1 T C 5: 72,604,878 D431G probably damaging Het
Dock8 G A 19: 25,171,619 R1487Q probably damaging Het
Farp1 T A 14: 121,222,667 V116D probably damaging Het
Fbxo24 T A 5: 137,619,681 T274S probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gatad2b T C 3: 90,351,441 L257P probably damaging Het
Gm20402 C T 3: 52,268,890 P30L probably damaging Het
Gm7932 C T 6: 48,862,859 noncoding transcript Het
Gpatch8 A T 11: 102,480,941 D590E unknown Het
Herc1 T G 9: 66,451,492 probably benign Het
Hsd3b2 T A 3: 98,711,559 I357F probably benign Het
Ipo5 A G 14: 120,919,984 Y78C probably damaging Het
Itga8 C A 2: 12,132,486 A23S probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat2a A G 11: 100,708,898 V451A possibly damaging Het
Knstrn A G 2: 118,830,955 probably benign Het
Med23 A G 10: 24,870,483 probably benign Het
Mefv A G 16: 3,715,715 Y231H probably benign Het
Olfr1425 A T 19: 12,074,083 I183N possibly damaging Het
Olfr1507 T A 14: 52,490,167 I266F probably benign Het
Olfr494 T A 7: 108,367,601 I37N probably damaging Het
Olfr935 A G 9: 38,995,415 S7P probably damaging Het
Pak7 G T 2: 136,116,463 T235K probably benign Het
Plppr3 G T 10: 79,866,126 P294Q probably benign Het
Prepl A G 17: 85,064,649 F725L probably benign Het
Ptchd3 A T 11: 121,836,587 probably benign Het
Rprd2 T C 3: 95,764,863 E1076G probably damaging Het
Sarm1 C A 11: 78,490,602 E352* probably null Het
Sccpdh T A 1: 179,680,588 H14Q probably benign Het
Senp7 A G 16: 56,169,871 I661V probably benign Het
Sept3 T C 15: 82,290,427 F140L probably damaging Het
Spag6 G T 2: 18,710,606 Q65H probably damaging Het
Tnni3 C T 7: 4,519,540 R137H probably damaging Het
Trank1 A G 9: 111,365,133 S742G probably benign Het
Ucn3 T C 13: 3,941,413 I80V probably benign Het
Ulk2 A T 11: 61,803,796 probably benign Het
Uncx C T 5: 139,547,629 S483L probably benign Het
Vps39 A G 2: 120,324,662 V550A probably damaging Het
Zfp697 C A 3: 98,428,593 T558K probably damaging Het
Zfp790 G T 7: 29,829,504 G538V probably damaging Het
Other mutations in Chdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Chdh APN 14 30031332 missense probably benign 0.15
IGL01309:Chdh APN 14 30035804 unclassified probably benign
IGL01515:Chdh APN 14 30036886 missense probably damaging 1.00
IGL01828:Chdh APN 14 30036608 missense probably damaging 0.96
IGL01953:Chdh APN 14 30035347 missense probably benign 0.24
IGL01989:Chdh APN 14 30031731 missense possibly damaging 0.71
IGL02325:Chdh APN 14 30032825 missense probably benign 0.01
IGL02620:Chdh APN 14 30031139 missense probably damaging 0.99
IGL03180:Chdh APN 14 30034602 splice site probably null
R0024:Chdh UTSW 14 30031596 missense possibly damaging 0.81
R0455:Chdh UTSW 14 30034646 missense probably damaging 1.00
R0486:Chdh UTSW 14 30032858 missense possibly damaging 0.83
R0668:Chdh UTSW 14 30035880 missense probably damaging 1.00
R0684:Chdh UTSW 14 30031613 missense probably damaging 1.00
R0971:Chdh UTSW 14 30033663 missense probably damaging 1.00
R1291:Chdh UTSW 14 30031562 nonsense probably null
R1381:Chdh UTSW 14 30036834 missense probably damaging 1.00
R1386:Chdh UTSW 14 30031434 missense probably damaging 1.00
R1412:Chdh UTSW 14 30034723 missense probably benign 0.01
R1912:Chdh UTSW 14 30032788 missense probably benign 0.00
R2198:Chdh UTSW 14 30031532 missense possibly damaging 0.91
R4077:Chdh UTSW 14 30035340 missense probably damaging 0.99
R4412:Chdh UTSW 14 30031715 missense probably damaging 1.00
R4713:Chdh UTSW 14 30036841 missense probably benign 0.28
R4865:Chdh UTSW 14 30033724 missense probably benign 0.00
R4940:Chdh UTSW 14 30032852 missense possibly damaging 0.82
R5207:Chdh UTSW 14 30031361 missense probably damaging 1.00
R5582:Chdh UTSW 14 30036859 missense probably damaging 1.00
R5710:Chdh UTSW 14 30034627 missense probably damaging 1.00
R6245:Chdh UTSW 14 30035305 missense probably damaging 0.99
R7032:Chdh UTSW 14 30036852 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TATCATGCGCCATGGCCTTG -3'
(R):5'- CCATCAACAAGTCCTTAGGTCCTG -3'

Sequencing Primer
(F):5'- GGCCTTGCCCAAGCTAG -3'
(R):5'- AAGTCCTTAGGTCCTGCCTCTAG -3'
Posted On2017-03-31