Incidental Mutation 'R5954:Ipo5'
ID471070
Institutional Source Beutler Lab
Gene Symbol Ipo5
Ensembl Gene ENSMUSG00000030662
Gene Nameimportin 5
SynonymsRanbp5, Kpnb3, 5730478E03Rik, IMB3, 1110011C18Rik
MMRRC Submission 044143-MU
Accession Numbers

Genbank: NM_023579; MGI: 1917822

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R5954 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location120911224-120947999 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120919984 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 78 (Y78C)
Ref Sequence ENSEMBL: ENSMUSP00000032898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032898]
Predicted Effect probably damaging
Transcript: ENSMUST00000032898
AA Change: Y78C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: Y78C

DomainStartEndE-ValueType
low complexity region 65 72 N/A INTRINSIC
Pfam:HEAT_2 359 467 3.3e-13 PFAM
Pfam:HEAT_EZ 372 426 3.7e-10 PFAM
Pfam:Vac14_Fab1_bd 373 430 3.8e-9 PFAM
Pfam:HEAT 400 430 4.2e-7 PFAM
Pfam:HEAT 906 936 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228277
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,416 I944T probably benign Het
Ank2 T C 3: 126,997,861 T823A probably benign Het
Ankrd42 C G 7: 92,623,967 probably null Het
Anks4b T A 7: 120,182,173 N142K possibly damaging Het
Armc5 A G 7: 128,242,272 E484G probably benign Het
B4galnt3 A G 6: 120,225,188 F118L possibly damaging Het
Bbs12 C T 3: 37,320,002 L200F possibly damaging Het
Cacna1h A G 17: 25,383,201 F1555S probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Chd6 A C 2: 160,965,827 H1822Q probably benign Het
Chdh C T 14: 30,031,181 R16C possibly damaging Het
Cnga1 T C 5: 72,604,878 D431G probably damaging Het
Dock8 G A 19: 25,171,619 R1487Q probably damaging Het
Farp1 T A 14: 121,222,667 V116D probably damaging Het
Fbxo24 T A 5: 137,619,681 T274S probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gatad2b T C 3: 90,351,441 L257P probably damaging Het
Gm20402 C T 3: 52,268,890 P30L probably damaging Het
Gm7932 C T 6: 48,862,859 noncoding transcript Het
Gpatch8 A T 11: 102,480,941 D590E unknown Het
Herc1 T G 9: 66,451,492 probably benign Het
Hsd3b2 T A 3: 98,711,559 I357F probably benign Het
Itga8 C A 2: 12,132,486 A23S probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat2a A G 11: 100,708,898 V451A possibly damaging Het
Knstrn A G 2: 118,830,955 probably benign Het
Med23 A G 10: 24,870,483 probably benign Het
Mefv A G 16: 3,715,715 Y231H probably benign Het
Olfr1425 A T 19: 12,074,083 I183N possibly damaging Het
Olfr1507 T A 14: 52,490,167 I266F probably benign Het
Olfr494 T A 7: 108,367,601 I37N probably damaging Het
Olfr935 A G 9: 38,995,415 S7P probably damaging Het
Pak7 G T 2: 136,116,463 T235K probably benign Het
Plppr3 G T 10: 79,866,126 P294Q probably benign Het
Prepl A G 17: 85,064,649 F725L probably benign Het
Ptchd3 A T 11: 121,836,587 probably benign Het
Rprd2 T C 3: 95,764,863 E1076G probably damaging Het
Sarm1 C A 11: 78,490,602 E352* probably null Het
Sccpdh T A 1: 179,680,588 H14Q probably benign Het
Senp7 A G 16: 56,169,871 I661V probably benign Het
Sept3 T C 15: 82,290,427 F140L probably damaging Het
Spag6 G T 2: 18,710,606 Q65H probably damaging Het
Tnni3 C T 7: 4,519,540 R137H probably damaging Het
Trank1 A G 9: 111,365,133 S742G probably benign Het
Ucn3 T C 13: 3,941,413 I80V probably benign Het
Ulk2 A T 11: 61,803,796 probably benign Het
Uncx C T 5: 139,547,629 S483L probably benign Het
Vps39 A G 2: 120,324,662 V550A probably damaging Het
Zfp697 C A 3: 98,428,593 T558K probably damaging Het
Zfp790 G T 7: 29,829,504 G538V probably damaging Het
Other mutations in Ipo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ipo5 APN 14 120928533 missense probably damaging 0.98
IGL01614:Ipo5 APN 14 120935095 missense probably benign 0.01
IGL01835:Ipo5 APN 14 120926238 missense probably benign 0.24
IGL02010:Ipo5 APN 14 120933377 missense probably benign 0.20
IGL02303:Ipo5 APN 14 120917383 missense probably benign
IGL02344:Ipo5 APN 14 120942779 splice site probably benign
IGL02657:Ipo5 APN 14 120943800 missense possibly damaging 0.47
IGL03094:Ipo5 APN 14 120943677 splice site probably benign
IGL03158:Ipo5 APN 14 120941891 splice site probably benign
IGL03309:Ipo5 APN 14 120920004 missense probably benign
IGL03392:Ipo5 APN 14 120942687 missense probably damaging 0.99
3-1:Ipo5 UTSW 14 120932936 missense probably benign 0.41
PIT4544001:Ipo5 UTSW 14 120928537 missense probably damaging 0.99
R0326:Ipo5 UTSW 14 120922223 missense probably benign 0.19
R0505:Ipo5 UTSW 14 120942733 missense possibly damaging 0.74
R0559:Ipo5 UTSW 14 120938641 missense probably damaging 1.00
R0590:Ipo5 UTSW 14 120944357 missense possibly damaging 0.76
R0969:Ipo5 UTSW 14 120944525 missense possibly damaging 0.64
R1450:Ipo5 UTSW 14 120944393 missense probably benign 0.04
R1672:Ipo5 UTSW 14 120933302 missense probably damaging 1.00
R2471:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R3508:Ipo5 UTSW 14 120939544 missense probably damaging 1.00
R3696:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R4118:Ipo5 UTSW 14 120938661 missense probably benign 0.04
R4418:Ipo5 UTSW 14 120943893 missense possibly damaging 0.81
R4760:Ipo5 UTSW 14 120941642 missense probably benign 0.02
R4839:Ipo5 UTSW 14 120920038 missense probably benign 0.00
R4913:Ipo5 UTSW 14 120935086 missense probably damaging 1.00
R5326:Ipo5 UTSW 14 120926271 missense probably benign
R5339:Ipo5 UTSW 14 120943710 missense probably damaging 1.00
R5483:Ipo5 UTSW 14 120920038 missense probably benign 0.06
R5542:Ipo5 UTSW 14 120926271 missense probably benign
R5579:Ipo5 UTSW 14 120938613 missense probably benign 0.26
R6948:Ipo5 UTSW 14 120923115 missense probably benign 0.00
R7365:Ipo5 UTSW 14 120920085 missense probably benign
W0251:Ipo5 UTSW 14 120938785 missense probably benign 0.17
X0062:Ipo5 UTSW 14 120941671 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCAAACTGAGCAGGTGAGG -3'
(R):5'- CATGCATGTGCCAGGACAAC -3'

Sequencing Primer
(F):5'- TTCCCCCAAAAGTATCGAGTTG -3'
(R):5'- CATGCATGTGCCAGGACAACTTAAG -3'
Posted On2017-03-31