Incidental Mutation 'R5954:Sept3'
ID471072
Institutional Source Beutler Lab
Gene Symbol Sept3
Ensembl Gene ENSMUSG00000022456
Gene Nameseptin 3
SynonymsB530002E20Rik, Sep3, 3110018K01Rik
MMRRC Submission 044143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5954 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82274893-82294574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82290427 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 140 (F140L)
Ref Sequence ENSEMBL: ENSMUSP00000155353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023095] [ENSMUST00000116423] [ENSMUST00000230365] [ENSMUST00000230418] [ENSMUST00000230507]
Predicted Effect probably damaging
Transcript: ENSMUST00000023095
AA Change: F284L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023095
Gene: ENSMUSG00000022456
AA Change: F284L

DomainStartEndE-ValueType
Pfam:DUF258 27 143 9.1e-9 PFAM
Pfam:Septin 45 322 8.9e-117 PFAM
Pfam:AIG1 49 145 2.6e-7 PFAM
Pfam:MMR_HSR1 50 220 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116423
AA Change: F284L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112124
Gene: ENSMUSG00000022456
AA Change: F284L

DomainStartEndE-ValueType
Pfam:Septin 45 322 1.2e-116 PFAM
Pfam:MMR_HSR1 50 195 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229067
Predicted Effect possibly damaging
Transcript: ENSMUST00000230365
AA Change: F284L

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000230418
Predicted Effect probably damaging
Transcript: ENSMUST00000230507
AA Change: F140L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230799
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the septin family of GTPases. Members of this family are required for cytokinesis. Expression is upregulated by retinoic acid in a human teratocarcinoma cell line. The specific function of this gene has not been determined. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,416 I944T probably benign Het
Ank2 T C 3: 126,997,861 T823A probably benign Het
Ankrd42 C G 7: 92,623,967 probably null Het
Anks4b T A 7: 120,182,173 N142K possibly damaging Het
Armc5 A G 7: 128,242,272 E484G probably benign Het
B4galnt3 A G 6: 120,225,188 F118L possibly damaging Het
Bbs12 C T 3: 37,320,002 L200F possibly damaging Het
Cacna1h A G 17: 25,383,201 F1555S probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Chd6 A C 2: 160,965,827 H1822Q probably benign Het
Chdh C T 14: 30,031,181 R16C possibly damaging Het
Cnga1 T C 5: 72,604,878 D431G probably damaging Het
Dock8 G A 19: 25,171,619 R1487Q probably damaging Het
Farp1 T A 14: 121,222,667 V116D probably damaging Het
Fbxo24 T A 5: 137,619,681 T274S probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gatad2b T C 3: 90,351,441 L257P probably damaging Het
Gm20402 C T 3: 52,268,890 P30L probably damaging Het
Gm7932 C T 6: 48,862,859 noncoding transcript Het
Gpatch8 A T 11: 102,480,941 D590E unknown Het
Herc1 T G 9: 66,451,492 probably benign Het
Hsd3b2 T A 3: 98,711,559 I357F probably benign Het
Ipo5 A G 14: 120,919,984 Y78C probably damaging Het
Itga8 C A 2: 12,132,486 A23S probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat2a A G 11: 100,708,898 V451A possibly damaging Het
Knstrn A G 2: 118,830,955 probably benign Het
Med23 A G 10: 24,870,483 probably benign Het
Mefv A G 16: 3,715,715 Y231H probably benign Het
Olfr1425 A T 19: 12,074,083 I183N possibly damaging Het
Olfr1507 T A 14: 52,490,167 I266F probably benign Het
Olfr494 T A 7: 108,367,601 I37N probably damaging Het
Olfr935 A G 9: 38,995,415 S7P probably damaging Het
Pak7 G T 2: 136,116,463 T235K probably benign Het
Plppr3 G T 10: 79,866,126 P294Q probably benign Het
Prepl A G 17: 85,064,649 F725L probably benign Het
Ptchd3 A T 11: 121,836,587 probably benign Het
Rprd2 T C 3: 95,764,863 E1076G probably damaging Het
Sarm1 C A 11: 78,490,602 E352* probably null Het
Sccpdh T A 1: 179,680,588 H14Q probably benign Het
Senp7 A G 16: 56,169,871 I661V probably benign Het
Spag6 G T 2: 18,710,606 Q65H probably damaging Het
Tnni3 C T 7: 4,519,540 R137H probably damaging Het
Trank1 A G 9: 111,365,133 S742G probably benign Het
Ucn3 T C 13: 3,941,413 I80V probably benign Het
Ulk2 A T 11: 61,803,796 probably benign Het
Uncx C T 5: 139,547,629 S483L probably benign Het
Vps39 A G 2: 120,324,662 V550A probably damaging Het
Zfp697 C A 3: 98,428,593 T558K probably damaging Het
Zfp790 G T 7: 29,829,504 G538V probably damaging Het
Other mutations in Sept3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Sept3 APN 15 82279613 unclassified probably benign
IGL01979:Sept3 APN 15 82284392 missense probably damaging 0.99
IGL03118:Sept3 APN 15 82284514 splice site probably null
R0478:Sept3 UTSW 15 82290806 missense probably damaging 1.00
R0556:Sept3 UTSW 15 82283765 unclassified probably benign
R3804:Sept3 UTSW 15 82286429 splice site probably benign
R3876:Sept3 UTSW 15 82285801 missense probably damaging 1.00
R4589:Sept3 UTSW 15 82285891 missense probably damaging 0.99
R4744:Sept3 UTSW 15 82290457 critical splice donor site probably null
R6434:Sept3 UTSW 15 82279603 missense possibly damaging 0.92
R7257:Sept3 UTSW 15 82289213 missense probably damaging 0.99
R7475:Sept3 UTSW 15 82286456 missense probably benign 0.00
X0065:Sept3 UTSW 15 82279504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTACCGTGTCCATTAGACCTG -3'
(R):5'- AATTTTACAACCCCTCTGAGATGC -3'

Sequencing Primer
(F):5'- CCTGATTTTAAAAGTATTTGCTCGG -3'
(R):5'- CCTCTGAGATGCACTGGGATAG -3'
Posted On2017-03-31