Incidental Mutation 'R5955:Ago3'
ID471097
Institutional Source Beutler Lab
Gene Symbol Ago3
Ensembl Gene ENSMUSG00000028842
Gene Nameargonaute RISC catalytic subunit 3
SynonymseIF2C3, argonaute 3, C130014L07Rik
Accession Numbers

Genbank: NM_153402; MGI: 2446634

Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R5955 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126331704-126429556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126355050 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 569 (N569K)
Ref Sequence ENSEMBL: ENSMUSP00000066633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069097] [ENSMUST00000127831] [ENSMUST00000132123]
Predicted Effect probably damaging
Transcript: ENSMUST00000069097
AA Change: N569K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066633
Gene: ENSMUSG00000028842
AA Change: N569K

DomainStartEndE-ValueType
Pfam:ArgoN 20 167 9.4e-26 PFAM
DUF1785 176 228 3.48e-25 SMART
PAZ 236 371 4.18e-4 SMART
Pfam:ArgoL2 376 421 1.3e-14 PFAM
Pfam:ArgoMid 430 512 1.4e-34 PFAM
Piwi 518 819 2.96e-136 SMART
Blast:Piwi 826 852 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127831
SMART Domains Protein: ENSMUSP00000118577
Gene: ENSMUSG00000028842

DomainStartEndE-ValueType
Piwi 1 125 9.56e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132123
SMART Domains Protein: ENSMUSP00000116204
Gene: ENSMUSG00000028842

DomainStartEndE-ValueType
Piwi 1 140 1.41e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Gene trapped(22)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
Abcc2 A T 19: 43,813,190 D632V probably damaging Het
Acbd6 C T 1: 155,587,459 A135V probably benign Het
Adam26a A T 8: 43,569,852 F200L probably benign Het
Ak9 A T 10: 41,358,564 L640F probably damaging Het
Ampd2 A G 3: 108,079,772 V178A probably damaging Het
Anapc4 C G 5: 52,865,946 H710D probably benign Het
Atad2 T C 15: 58,105,659 I495V probably benign Het
Bhmt2 T C 13: 93,663,197 T244A probably benign Het
Capg T C 6: 72,555,500 V16A probably benign Het
Capn13 A G 17: 73,331,002 F469L possibly damaging Het
Ccdc149 C T 5: 52,376,535 V430I probably benign Het
Cma1 A C 14: 55,943,769 Y47D probably benign Het
Col6a3 A T 1: 90,811,441 L355Q probably damaging Het
Crocc G T 4: 141,017,918 T1796K possibly damaging Het
Cyp2c50 A T 19: 40,090,943 probably null Het
Dsp T C 13: 38,194,958 I1294T possibly damaging Het
Erbin A T 13: 103,830,192 F1250Y probably benign Het
Fbn1 A C 2: 125,358,882 C1298W probably damaging Het
Fbn2 A C 18: 58,044,256 F1990V probably damaging Het
Fez2 A T 17: 78,387,043 V306D probably damaging Het
Gigyf1 G A 5: 137,523,507 probably null Het
Gjb4 A T 4: 127,351,952 Y65* probably null Het
Gm26661 G A 14: 7,791,776 A64T unknown Het
Igkv1-135 T C 6: 67,610,279 S45P possibly damaging Het
Il27 T C 7: 126,594,898 T5A probably benign Het
Il27ra T C 8: 84,040,822 D124G probably benign Het
Itgad A G 7: 128,189,481 H424R probably benign Het
Itgal T C 7: 127,304,989 V258A possibly damaging Het
Kpna4 A G 3: 69,089,801 V351A probably benign Het
Lama5 T C 2: 180,197,474 Q747R probably damaging Het
Map4k5 A G 12: 69,844,390 F168L probably damaging Het
Mecom A G 3: 29,961,046 Y843H probably damaging Het
Mical3 T C 6: 121,033,750 M424V probably damaging Het
Myb A G 10: 21,152,499 I155T probably damaging Het
Nbea A T 3: 55,680,983 V2445E probably benign Het
Nlrp1b A T 11: 71,217,865 I270N probably damaging Het
Nlrp4f A T 13: 65,195,081 M250K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 T A 4: 43,854,898 N196K probably damaging Het
Olfr692 C T 7: 105,368,569 A72V probably damaging Het
P4ha1 A G 10: 59,342,796 S96G probably benign Het
Pcnt G T 10: 76,411,622 N1025K possibly damaging Het
Phactr4 A G 4: 132,386,909 F58S probably damaging Het
Phlpp1 T A 1: 106,364,230 probably null Het
Rab40c A C 17: 25,884,657 V144G probably damaging Het
Rnasel A G 1: 153,754,400 I221V probably benign Het
Rps6kb1 T C 11: 86,513,605 K241E probably damaging Het
Rrbp1 C G 2: 143,949,677 E1370Q probably benign Het
Rttn T C 18: 89,121,009 Y2111H probably damaging Het
Samd8 A G 14: 21,793,084 H364R probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Setdb1 A G 3: 95,338,842 Y590H probably damaging Het
Shkbp1 T C 7: 27,342,524 N635S probably benign Het
Tdgf1 C A 9: 110,944,213 R18L unknown Het
Tmem246 T C 4: 49,586,613 E185G probably damaging Het
Trpm6 A G 19: 18,892,019 D1990G possibly damaging Het
Usp48 A G 4: 137,615,818 N426S probably benign Het
Vmn2r16 G A 5: 109,363,747 V607M possibly damaging Het
Xdh A T 17: 73,898,320 V1050D probably damaging Het
Zfp110 C T 7: 12,848,745 T440I possibly damaging Het
Other mutations in Ago3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ago3 APN 4 126371541 missense probably damaging 1.00
IGL01826:Ago3 APN 4 126403282 missense probably damaging 1.00
IGL02285:Ago3 APN 4 126350877 missense possibly damaging 0.88
IGL02869:Ago3 APN 4 126367787 splice site probably benign
IGL03068:Ago3 APN 4 126417378 missense probably damaging 0.99
D4043:Ago3 UTSW 4 126351003 missense probably damaging 1.00
R0506:Ago3 UTSW 4 126417252 missense possibly damaging 0.79
R0545:Ago3 UTSW 4 126417232 missense probably damaging 1.00
R0764:Ago3 UTSW 4 126355092 missense possibly damaging 0.82
R1445:Ago3 UTSW 4 126371787 missense probably benign
R1706:Ago3 UTSW 4 126370292 missense probably damaging 1.00
R1909:Ago3 UTSW 4 126346737 missense probably damaging 1.00
R1944:Ago3 UTSW 4 126353727 missense probably damaging 1.00
R1974:Ago3 UTSW 4 126346751 missense probably damaging 1.00
R2239:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2380:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2424:Ago3 UTSW 4 126404247 missense probably damaging 1.00
R2571:Ago3 UTSW 4 126363811 missense probably damaging 1.00
R3121:Ago3 UTSW 4 126417372 missense probably benign
R3122:Ago3 UTSW 4 126417372 missense probably benign
R4022:Ago3 UTSW 4 126368593 missense probably benign 0.31
R4079:Ago3 UTSW 4 126353680 critical splice donor site probably null
R4272:Ago3 UTSW 4 126355091 missense possibly damaging 0.95
R4533:Ago3 UTSW 4 126345563 missense probably damaging 1.00
R4575:Ago3 UTSW 4 126346682 missense probably benign 0.06
R4656:Ago3 UTSW 4 126363752 nonsense probably null
R4782:Ago3 UTSW 4 126347872 splice site probably null
R4783:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4784:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4785:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4799:Ago3 UTSW 4 126347872 splice site probably null
R5013:Ago3 UTSW 4 126368598 missense probably benign 0.18
R5180:Ago3 UTSW 4 126367751 missense probably benign 0.01
R5692:Ago3 UTSW 4 126355069 unclassified probably null
R5801:Ago3 UTSW 4 126371768 missense possibly damaging 0.53
R6730:Ago3 UTSW 4 126371545 missense probably null 0.04
T0722:Ago3 UTSW 4 126404263 missense probably benign
T0722:Ago3 UTSW 4 126404296 missense probably benign 0.21
T0722:Ago3 UTSW 4 126404305 missense probably benign
T0722:Ago3 UTSW 4 126404310 missense probably benign 0.00
T0975:Ago3 UTSW 4 126404263 missense probably benign
T0975:Ago3 UTSW 4 126404305 missense probably benign
T0975:Ago3 UTSW 4 126404310 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTATTGGTTAAATTCTCTGCCTC -3'
(R):5'- TCCTTCATAGCTTTACTGTTAAGGGG -3'

Sequencing Primer
(F):5'- AGACAGGGTCTCACTGTATAGTCC -3'
(R):5'- ACACTTTTGGGTATGGCC -3'
Posted On2017-03-31