Incidental Mutation 'R0501:Vmn2r8'
ID47110
Institutional Source Beutler Lab
Gene Symbol Vmn2r8
Ensembl Gene ENSMUSG00000090961
Gene Namevomeronasal 2, receptor 8
SynonymsEG627479
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108797193-108808754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108803183 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 132 (D132G)
Ref Sequence ENSEMBL: ENSMUSP00000126953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172140]
Predicted Effect probably benign
Transcript: ENSMUST00000172140
AA Change: D132G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961
AA Change: D132G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 419 1.1e-28 PFAM
Pfam:NCD3G 507 561 8.2e-18 PFAM
Pfam:7tm_3 594 829 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Vmn2r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn2r8 APN 5 108802225 missense probably benign 0.01
R0324:Vmn2r8 UTSW 5 108797941 unclassified probably null
R0335:Vmn2r8 UTSW 5 108797451 unclassified probably null
R0394:Vmn2r8 UTSW 5 108802072 missense probably benign 0.12
R0615:Vmn2r8 UTSW 5 108799329 missense probably damaging 1.00
R0678:Vmn2r8 UTSW 5 108800546 missense probably benign 0.00
R1167:Vmn2r8 UTSW 5 108803176 missense probably benign 0.01
R1187:Vmn2r8 UTSW 5 108803219 nonsense probably null
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1451:Vmn2r8 UTSW 5 108798067 missense probably damaging 1.00
R1535:Vmn2r8 UTSW 5 108802174 missense probably damaging 1.00
R1795:Vmn2r8 UTSW 5 108803106 missense probably benign
R1874:Vmn2r8 UTSW 5 108802418 missense possibly damaging 0.74
R1908:Vmn2r8 UTSW 5 108797570 missense probably benign 0.03
R1925:Vmn2r8 UTSW 5 108802153 missense probably damaging 0.97
R1960:Vmn2r8 UTSW 5 108799286 missense probably damaging 0.99
R1961:Vmn2r8 UTSW 5 108798095 missense probably benign 0.45
R1967:Vmn2r8 UTSW 5 108802383 missense probably benign 0.01
R2095:Vmn2r8 UTSW 5 108808621 missense possibly damaging 0.94
R2159:Vmn2r8 UTSW 5 108802303 missense probably benign 0.22
R4240:Vmn2r8 UTSW 5 108797503 missense probably damaging 0.99
R4581:Vmn2r8 UTSW 5 108801704 missense probably benign 0.03
R4744:Vmn2r8 UTSW 5 108808581 missense probably benign 0.00
R4755:Vmn2r8 UTSW 5 108801700 missense probably benign 0.03
R4917:Vmn2r8 UTSW 5 108797398 missense probably damaging 1.00
R4957:Vmn2r8 UTSW 5 108799263 missense probably benign 0.16
R5141:Vmn2r8 UTSW 5 108808706 missense probably damaging 0.96
R5481:Vmn2r8 UTSW 5 108801770 missense probably benign 0.09
R5571:Vmn2r8 UTSW 5 108802240 missense probably damaging 1.00
R5624:Vmn2r8 UTSW 5 108802459 missense probably damaging 0.99
R6003:Vmn2r8 UTSW 5 108797382 missense probably damaging 1.00
R6243:Vmn2r8 UTSW 5 108799345 missense probably benign 0.01
R6265:Vmn2r8 UTSW 5 108808597 missense probably benign
R6315:Vmn2r8 UTSW 5 108801891 missense probably benign
R6413:Vmn2r8 UTSW 5 108801723 missense probably benign 0.09
R7120:Vmn2r8 UTSW 5 108808638 missense possibly damaging 0.56
Z1088:Vmn2r8 UTSW 5 108801998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTCTAAGTTTTCTTTCAGGCACG -3'
(R):5'- GGCAGTACTCTGGCTCTCCTTAGTATAA -3'

Sequencing Primer
(F):5'- acagtggctcacaaccatc -3'
(R):5'- TCTAGATCAAGGTCAGCATTCAGAG -3'
Posted On2013-06-12