Incidental Mutation 'R5956:Ddx31'
ID471161
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Synonyms
MMRRC Submission 044144-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R5956 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28840406-28905571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28874173 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 464 (I464F)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: I464F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: I464F

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,157,119 I398K possibly damaging Het
A530099J19Rik T G 13: 19,729,130 noncoding transcript Het
Acad9 A G 3: 36,075,174 probably benign Het
Acsm2 T C 7: 119,554,481 S5P unknown Het
Akp3 T C 1: 87,126,945 I334T probably damaging Het
Amy1 C T 3: 113,563,662 R176H probably benign Het
Ank2 A T 3: 126,942,688 probably benign Het
Cav1 C A 6: 17,307,919 N23K probably damaging Het
Cep126 A G 9: 8,112,119 V151A probably benign Het
Cnot1 A G 8: 95,754,978 probably null Het
Crim1 T A 17: 78,315,717 V448E probably damaging Het
Csmd3 T C 15: 48,791,882 E8G possibly damaging Het
Ddx54 A G 5: 120,626,367 probably benign Het
Dhx16 A G 17: 35,882,870 E319G probably damaging Het
Efl1 A G 7: 82,651,899 D37G probably damaging Het
Epha5 T C 5: 84,150,369 R444G probably damaging Het
Exoc2 C A 13: 30,820,623 C859F probably benign Het
Gbx2 T C 1: 89,933,186 probably benign Het
Gm12258 G A 11: 58,859,459 A9T probably benign Het
Gm1966 T C 7: 106,601,470 noncoding transcript Het
Grm4 A G 17: 27,435,155 V607A probably benign Het
Ighv1-74 C A 12: 115,802,835 W55L probably damaging Het
Irx4 C A 13: 73,267,507 Y138* probably null Het
Itpr1 C A 6: 108,506,027 T2352K probably benign Het
Kcnk3 T G 5: 30,588,510 V65G probably damaging Het
Mctp2 T C 7: 72,259,175 E130G probably benign Het
Mgat5 C A 1: 127,382,939 R197S probably benign Het
Mpg T C 11: 32,227,951 probably null Het
Muc5b T C 7: 141,864,173 C3619R probably damaging Het
Myo15b G A 11: 115,873,757 V1321I probably benign Het
Myo1b T C 1: 51,776,232 T658A probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nsd1 T A 13: 55,263,404 F1423I probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1012 A G 2: 85,753,839 probably benign Het
Osbpl6 A G 2: 76,549,512 R149G probably damaging Het
Papola T A 12: 105,811,041 W281R probably damaging Het
Pole C T 5: 110,337,287 probably benign Het
Rptn A G 3: 93,398,027 N889S possibly damaging Het
Scn10a A G 9: 119,631,560 S1084P probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Siglece T C 7: 43,659,336 T198A probably damaging Het
Sptb T A 12: 76,604,168 M1678L probably benign Het
Taf8 A T 17: 47,498,542 M98K probably damaging Het
Tead2 T A 7: 45,220,714 probably benign Het
Tmem206 A G 1: 191,348,371 S263G probably damaging Het
Trrap C T 5: 144,807,391 silent Het
Ttn G T 2: 76,945,570 N1709K probably damaging Het
Ube3a T C 7: 59,277,020 probably benign Het
Ube3c T C 5: 29,599,056 probably benign Het
Unc80 T C 1: 66,527,964 S910P probably damaging Het
Usp30 G A 5: 114,119,621 R280Q possibly damaging Het
Vsx1 T C 2: 150,688,537 S142G possibly damaging Het
Wdr95 T G 5: 149,594,482 C360G probably benign Het
Zbtb4 A G 11: 69,778,214 I588V probably benign Het
Zdhhc4 A T 5: 143,324,849 probably benign Het
Zfp568 C A 7: 29,997,863 N69K probably damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28875835 splice site probably benign
IGL01918:Ddx31 APN 2 28874164 missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28859029 missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28875826 missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28859023 missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28857132 missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28858777 missense probably null 1.00
R0729:Ddx31 UTSW 2 28874174 missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28857175 missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28881159 missense probably benign 0.00
R1608:Ddx31 UTSW 2 28859066 missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28892520 missense probably benign
R1674:Ddx31 UTSW 2 28858816 missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28892453 missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28858990 missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28858852 missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28904684 missense probably benign 0.00
R4972:Ddx31 UTSW 2 28860770 missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28846030 missense probably benign 0.03
R5358:Ddx31 UTSW 2 28863770 missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28886969 missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28859890 missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28844842 missense probably benign 0.00
R6245:Ddx31 UTSW 2 28844982 missense probably benign 0.00
R6463:Ddx31 UTSW 2 28847513 critical splice donor site probably null
R6647:Ddx31 UTSW 2 28875738 missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28874176 missense probably benign 0.26
R6917:Ddx31 UTSW 2 28892409 missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28848306 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCGGCCAGGAGTAGTAACAC -3'
(R):5'- TATGCCCTCTCCTGAGAATGCC -3'

Sequencing Primer
(F):5'- GCCAGGAGTAGTAACACACATTG -3'
(R):5'- TCCTGAGAATGCCGTCCTG -3'
Posted On2017-03-31