Incidental Mutation 'R5956:Olfr1012'
ID471164
Institutional Source Beutler Lab
Gene Symbol Olfr1012
Ensembl Gene ENSMUSG00000075210
Gene Nameolfactory receptor 1012
SynonymsGA_x6K02T2Q125-47239120-47238185, MOR213-6
MMRRC Submission 044144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.045) question?
Stock #R5956 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85757353-85762766 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 85753839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148952 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120884
Predicted Effect probably benign
Transcript: ENSMUST00000214255
Predicted Effect probably benign
Transcript: ENSMUST00000214958
Predicted Effect silent
Transcript: ENSMUST00000216831
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,157,119 I398K possibly damaging Het
A530099J19Rik T G 13: 19,729,130 noncoding transcript Het
Acad9 A G 3: 36,075,174 probably benign Het
Acsm2 T C 7: 119,554,481 S5P unknown Het
Akp3 T C 1: 87,126,945 I334T probably damaging Het
Amy1 C T 3: 113,563,662 R176H probably benign Het
Ank2 A T 3: 126,942,688 probably benign Het
Cav1 C A 6: 17,307,919 N23K probably damaging Het
Cep126 A G 9: 8,112,119 V151A probably benign Het
Cnot1 A G 8: 95,754,978 probably null Het
Crim1 T A 17: 78,315,717 V448E probably damaging Het
Csmd3 T C 15: 48,791,882 E8G possibly damaging Het
Ddx31 A T 2: 28,874,173 I464F probably damaging Het
Ddx54 A G 5: 120,626,367 probably benign Het
Dhx16 A G 17: 35,882,870 E319G probably damaging Het
Efl1 A G 7: 82,651,899 D37G probably damaging Het
Epha5 T C 5: 84,150,369 R444G probably damaging Het
Exoc2 C A 13: 30,820,623 C859F probably benign Het
Gbx2 T C 1: 89,933,186 probably benign Het
Gm12258 G A 11: 58,859,459 A9T probably benign Het
Gm1966 T C 7: 106,601,470 noncoding transcript Het
Grm4 A G 17: 27,435,155 V607A probably benign Het
Ighv1-74 C A 12: 115,802,835 W55L probably damaging Het
Irx4 C A 13: 73,267,507 Y138* probably null Het
Itpr1 C A 6: 108,506,027 T2352K probably benign Het
Kcnk3 T G 5: 30,588,510 V65G probably damaging Het
Mctp2 T C 7: 72,259,175 E130G probably benign Het
Mgat5 C A 1: 127,382,939 R197S probably benign Het
Mpg T C 11: 32,227,951 probably null Het
Muc5b T C 7: 141,864,173 C3619R probably damaging Het
Myo15b G A 11: 115,873,757 V1321I probably benign Het
Myo1b T C 1: 51,776,232 T658A probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nsd1 T A 13: 55,263,404 F1423I probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Osbpl6 A G 2: 76,549,512 R149G probably damaging Het
Papola T A 12: 105,811,041 W281R probably damaging Het
Pole C T 5: 110,337,287 probably benign Het
Rptn A G 3: 93,398,027 N889S possibly damaging Het
Scn10a A G 9: 119,631,560 S1084P probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Siglece T C 7: 43,659,336 T198A probably damaging Het
Sptb T A 12: 76,604,168 M1678L probably benign Het
Taf8 A T 17: 47,498,542 M98K probably damaging Het
Tead2 T A 7: 45,220,714 probably benign Het
Tmem206 A G 1: 191,348,371 S263G probably damaging Het
Trrap C T 5: 144,807,391 silent Het
Ttn G T 2: 76,945,570 N1709K probably damaging Het
Ube3a T C 7: 59,277,020 probably benign Het
Ube3c T C 5: 29,599,056 probably benign Het
Unc80 T C 1: 66,527,964 S910P probably damaging Het
Usp30 G A 5: 114,119,621 R280Q possibly damaging Het
Vsx1 T C 2: 150,688,537 S142G possibly damaging Het
Wdr95 T G 5: 149,594,482 C360G probably benign Het
Zbtb4 A G 11: 69,778,214 I588V probably benign Het
Zdhhc4 A T 5: 143,324,849 probably benign Het
Zfp568 C A 7: 29,997,863 N69K probably damaging Het
Other mutations in Olfr1012
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01799:Olfr1012 APN 2 85759642 missense probably benign 0.30
IGL02334:Olfr1012 APN 2 85760159 nonsense probably null
IGL03050:Olfr1012 UTSW 2 85759441 makesense probably null
R0399:Olfr1012 UTSW 2 85759904 missense possibly damaging 0.53
R1730:Olfr1012 UTSW 2 85760242 missense possibly damaging 0.91
R2142:Olfr1012 UTSW 2 85759677 missense probably benign 0.07
R2185:Olfr1012 UTSW 2 85760019 missense probably damaging 1.00
R2412:Olfr1012 UTSW 2 85759680 missense probably damaging 0.99
R3552:Olfr1012 UTSW 2 85759893 missense possibly damaging 0.46
R3785:Olfr1012 UTSW 2 85759453 missense probably benign 0.00
R4096:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R4097:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R5199:Olfr1012 UTSW 2 85760214 missense probably damaging 1.00
R5206:Olfr1012 UTSW 2 85759623 missense probably benign 0.31
R5444:Olfr1012 UTSW 2 85759919 missense probably benign 0.39
R5567:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R5570:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R6406:Olfr1012 UTSW 2 85760307 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGACAAAAGCATCTCCTTTGC -3'
(R):5'- GAGCGGATCTTCAGAATGGC -3'

Sequencing Primer
(F):5'- CTGGTTGCCTGGCTCAG -3'
(R):5'- CGGATCTTCAGAATGGCTACAATG -3'
Posted On2017-03-31