Incidental Mutation 'R5956:Acad9'
ID471166
Institutional Source Beutler Lab
Gene Symbol Acad9
Ensembl Gene ENSMUSG00000027710
Gene Nameacyl-Coenzyme A dehydrogenase family, member 9
Synonyms2600017P15Rik, NPD002, C630012L17Rik
MMRRC Submission 044144-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R5956 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location36065979-36092853 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 36075174 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011492] [ENSMUST00000196648] [ENSMUST00000197588]
Predicted Effect probably benign
Transcript: ENSMUST00000011492
SMART Domains Protein: ENSMUSP00000011492
Gene: ENSMUSG00000027710

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 69 177 1.2e-25 PFAM
Pfam:Acyl-CoA_dh_M 181 282 2e-27 PFAM
Pfam:Acyl-CoA_dh_1 294 445 9.6e-42 PFAM
Pfam:Acyl-CoA_dh_2 309 434 3.6e-12 PFAM
Blast:HisKA 448 550 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196535
Predicted Effect probably benign
Transcript: ENSMUST00000196648
SMART Domains Protein: ENSMUSP00000142557
Gene: ENSMUSG00000027710

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 69 156 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197344
Predicted Effect probably benign
Transcript: ENSMUST00000197588
SMART Domains Protein: ENSMUSP00000142995
Gene: ENSMUSG00000027710

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_1 16 155 1.9e-37 PFAM
Pfam:Acyl-CoA_dh_2 31 156 8.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198987
Meta Mutation Damage Score 0.0568 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,157,119 I398K possibly damaging Het
A530099J19Rik T G 13: 19,729,130 noncoding transcript Het
Acsm2 T C 7: 119,554,481 S5P unknown Het
Akp3 T C 1: 87,126,945 I334T probably damaging Het
Amy1 C T 3: 113,563,662 R176H probably benign Het
Ank2 A T 3: 126,942,688 probably benign Het
Cav1 C A 6: 17,307,919 N23K probably damaging Het
Cep126 A G 9: 8,112,119 V151A probably benign Het
Cnot1 A G 8: 95,754,978 probably null Het
Crim1 T A 17: 78,315,717 V448E probably damaging Het
Csmd3 T C 15: 48,791,882 E8G possibly damaging Het
Ddx31 A T 2: 28,874,173 I464F probably damaging Het
Ddx54 A G 5: 120,626,367 probably benign Het
Dhx16 A G 17: 35,882,870 E319G probably damaging Het
Efl1 A G 7: 82,651,899 D37G probably damaging Het
Epha5 T C 5: 84,150,369 R444G probably damaging Het
Exoc2 C A 13: 30,820,623 C859F probably benign Het
Gbx2 T C 1: 89,933,186 probably benign Het
Gm12258 G A 11: 58,859,459 A9T probably benign Het
Gm1966 T C 7: 106,601,470 noncoding transcript Het
Grm4 A G 17: 27,435,155 V607A probably benign Het
Ighv1-74 C A 12: 115,802,835 W55L probably damaging Het
Irx4 C A 13: 73,267,507 Y138* probably null Het
Itpr1 C A 6: 108,506,027 T2352K probably benign Het
Kcnk3 T G 5: 30,588,510 V65G probably damaging Het
Mctp2 T C 7: 72,259,175 E130G probably benign Het
Mgat5 C A 1: 127,382,939 R197S probably benign Het
Mpg T C 11: 32,227,951 probably null Het
Muc5b T C 7: 141,864,173 C3619R probably damaging Het
Myo15b G A 11: 115,873,757 V1321I probably benign Het
Myo1b T C 1: 51,776,232 T658A probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nsd1 T A 13: 55,263,404 F1423I probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1012 A G 2: 85,753,839 probably benign Het
Osbpl6 A G 2: 76,549,512 R149G probably damaging Het
Papola T A 12: 105,811,041 W281R probably damaging Het
Pole C T 5: 110,337,287 probably benign Het
Rptn A G 3: 93,398,027 N889S possibly damaging Het
Scn10a A G 9: 119,631,560 S1084P probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Siglece T C 7: 43,659,336 T198A probably damaging Het
Sptb T A 12: 76,604,168 M1678L probably benign Het
Taf8 A T 17: 47,498,542 M98K probably damaging Het
Tead2 T A 7: 45,220,714 probably benign Het
Tmem206 A G 1: 191,348,371 S263G probably damaging Het
Trrap C T 5: 144,807,391 silent Het
Ttn G T 2: 76,945,570 N1709K probably damaging Het
Ube3a T C 7: 59,277,020 probably benign Het
Ube3c T C 5: 29,599,056 probably benign Het
Unc80 T C 1: 66,527,964 S910P probably damaging Het
Usp30 G A 5: 114,119,621 R280Q possibly damaging Het
Vsx1 T C 2: 150,688,537 S142G possibly damaging Het
Wdr95 T G 5: 149,594,482 C360G probably benign Het
Zbtb4 A G 11: 69,778,214 I588V probably benign Het
Zdhhc4 A T 5: 143,324,849 probably benign Het
Zfp568 C A 7: 29,997,863 N69K probably damaging Het
Other mutations in Acad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Acad9 APN 3 36069762 missense probably benign 0.06
IGL01161:Acad9 APN 3 36090125 missense possibly damaging 0.93
IGL02016:Acad9 APN 3 36088486 critical splice acceptor site probably null
IGL02100:Acad9 APN 3 36081880 missense probably null 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0119:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R0499:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R1444:Acad9 UTSW 3 36078508 missense possibly damaging 0.80
R1564:Acad9 UTSW 3 36089429 missense possibly damaging 0.53
R2013:Acad9 UTSW 3 36073588 missense probably damaging 0.97
R2113:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R2412:Acad9 UTSW 3 36073591 missense probably benign 0.26
R2428:Acad9 UTSW 3 36090923 missense probably benign
R4214:Acad9 UTSW 3 36073603 missense probably damaging 0.99
R4291:Acad9 UTSW 3 36066188 missense probably benign 0.14
R4562:Acad9 UTSW 3 36066182 missense probably benign 0.31
R4679:Acad9 UTSW 3 36088840 missense possibly damaging 0.79
R4758:Acad9 UTSW 3 36073605 missense probably damaging 1.00
R4953:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R4970:Acad9 UTSW 3 36085525 missense probably damaging 1.00
R5137:Acad9 UTSW 3 36069771 missense probably benign 0.28
R5171:Acad9 UTSW 3 36074398 missense possibly damaging 0.94
R6285:Acad9 UTSW 3 36082175 missense probably benign 0.01
R6620:Acad9 UTSW 3 36066145 missense possibly damaging 0.93
R6880:Acad9 UTSW 3 36069705 splice site probably null
R6995:Acad9 UTSW 3 36085481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATCTTGTCTATAAGCGAGAG -3'
(R):5'- ATTTTGAGCAGACAGACCTGG -3'

Sequencing Primer
(F):5'- CTTGTCTATAAGCGAGAGGTCCTCAG -3'
(R):5'- CAGACCTGGCTGGCTCTGTTAG -3'
Posted On2017-03-31