Incidental Mutation 'R0501:Cntn4'
ID47118
Institutional Source Beutler Lab
Gene Symbol Cntn4
Ensembl Gene ENSMUSG00000064293
Gene Namecontactin 4
SynonymsBIG-2A, Axcam
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location105677660-106699310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106618335 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 471 (D471V)
Ref Sequence ENSEMBL: ENSMUSP00000108889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079416] [ENSMUST00000089208] [ENSMUST00000113258] [ENSMUST00000113260] [ENSMUST00000113261] [ENSMUST00000113264]
Predicted Effect probably damaging
Transcript: ENSMUST00000079416
AA Change: D471V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293
AA Change: D471V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089208
AA Change: D471V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293
AA Change: D471V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113258
AA Change: D471V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108883
Gene: ENSMUSG00000064293
AA Change: D471V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113260
AA Change: D471V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108885
Gene: ENSMUSG00000064293
AA Change: D471V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113261
AA Change: D471V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108886
Gene: ENSMUSG00000064293
AA Change: D471V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113264
AA Change: D471V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293
AA Change: D471V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132395
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Cntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cntn4 APN 6 106506225 missense probably damaging 1.00
IGL00725:Cntn4 APN 6 106662655 missense probably damaging 1.00
IGL01062:Cntn4 APN 6 106618278 splice site probably benign
IGL01432:Cntn4 APN 6 106678334 splice site probably benign
IGL01585:Cntn4 APN 6 106618328 nonsense probably null
IGL01710:Cntn4 APN 6 106550431 missense possibly damaging 0.87
IGL01870:Cntn4 APN 6 106489715 missense possibly damaging 0.95
IGL01933:Cntn4 APN 6 106694384 missense probably damaging 0.99
IGL01937:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL01945:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL02007:Cntn4 APN 6 106655529 missense probably benign 0.03
IGL02506:Cntn4 APN 6 106618388 missense probably benign 0.24
IGL02561:Cntn4 APN 6 106523509 missense probably damaging 1.00
IGL03080:Cntn4 APN 6 106655539 missense probably damaging 1.00
IGL03338:Cntn4 APN 6 106655589 missense probably damaging 0.98
IGL03097:Cntn4 UTSW 6 106353712 missense probably benign 0.10
LCD18:Cntn4 UTSW 6 106553940 intron probably benign
R0083:Cntn4 UTSW 6 106525369 missense possibly damaging 0.79
R0098:Cntn4 UTSW 6 106618424 splice site probably benign
R0626:Cntn4 UTSW 6 106662578 missense probably benign 0.07
R0633:Cntn4 UTSW 6 106679248 splice site probably null
R0730:Cntn4 UTSW 6 106550486 missense probably damaging 1.00
R0849:Cntn4 UTSW 6 106667457 missense probably damaging 1.00
R0883:Cntn4 UTSW 6 106667540 splice site probably benign
R0926:Cntn4 UTSW 6 106655581 missense probably benign 0.21
R1199:Cntn4 UTSW 6 106353597 splice site probably benign
R1293:Cntn4 UTSW 6 106353724 missense probably benign 0.00
R1296:Cntn4 UTSW 6 106509402 missense probably damaging 1.00
R1344:Cntn4 UTSW 6 106344870 splice site probably null
R1418:Cntn4 UTSW 6 106344870 splice site probably null
R1660:Cntn4 UTSW 6 106679297 missense probably benign 0.35
R1751:Cntn4 UTSW 6 106618410 critical splice donor site probably null
R1883:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1884:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1899:Cntn4 UTSW 6 106675813 missense probably benign 0.21
R1906:Cntn4 UTSW 6 106353646 missense probably benign 0.00
R2048:Cntn4 UTSW 6 106437864 splice site probably benign
R2113:Cntn4 UTSW 6 106489697 missense probably damaging 1.00
R3177:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3277:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3944:Cntn4 UTSW 6 106618414 missense probably benign 0.10
R4401:Cntn4 UTSW 6 106489664 missense possibly damaging 0.94
R4540:Cntn4 UTSW 6 106675748 missense probably damaging 1.00
R4688:Cntn4 UTSW 6 106437949 missense probably damaging 1.00
R4697:Cntn4 UTSW 6 106525485 missense probably damaging 1.00
R4810:Cntn4 UTSW 6 106655611 missense probably benign 0.04
R4816:Cntn4 UTSW 6 106550497 missense probably benign
R4873:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4875:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4953:Cntn4 UTSW 6 106525418 missense probably benign 0.01
R5288:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5336:Cntn4 UTSW 6 106662634 missense possibly damaging 0.72
R5386:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5477:Cntn4 UTSW 6 106673950 missense possibly damaging 0.88
R5514:Cntn4 UTSW 6 106672883 missense probably damaging 1.00
R5668:Cntn4 UTSW 6 106679436 splice site silent
R6334:Cntn4 UTSW 6 106344786 missense probably benign
R6334:Cntn4 UTSW 6 106506192 missense probably benign 0.29
R6904:Cntn4 UTSW 6 106697583 missense probably benign 0.03
R6985:Cntn4 UTSW 6 106679417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAGACGAGGCTGTCAAATGATGTAAC -3'
(R):5'- AGCACAGGGTTCCTAGACATGAATTTC -3'

Sequencing Primer
(F):5'- GTTTCTCACGAGATAAACATCACA -3'
(R):5'- TTCATTACCAACAGTTCTCGAAG -3'
Posted On2013-06-12