Incidental Mutation 'R0501:Olfr705'
ID47121
Institutional Source Beutler Lab
Gene Symbol Olfr705
Ensembl Gene ENSMUSG00000109058
Gene Nameolfactory receptor 705
SynonymsGA_x6K02T2PBJ9-9256348-9255398, MOR283-2
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106871870-106876891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106714603 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 26 (M26K)
Ref Sequence ENSEMBL: ENSMUSP00000149773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080925] [ENSMUST00000216868]
Predicted Effect probably benign
Transcript: ENSMUST00000080925
AA Change: M26K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079726
Gene: ENSMUSG00000073900
AA Change: M26K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.5e-7 PFAM
Pfam:7tm_1 41 290 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216868
AA Change: M26K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Olfr705
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Olfr705 APN 7 106714334 missense possibly damaging 0.48
IGL02203:Olfr705 APN 7 106714630 missense probably benign 0.02
IGL02342:Olfr705 APN 7 106714025 missense probably benign 0.13
IGL02544:Olfr705 APN 7 106714535 missense probably benign 0.39
IGL02569:Olfr705 APN 7 106714586 missense probably benign 0.00
PIT4651001:Olfr705 UTSW 7 106873523 missense probably damaging 1.00
R0504:Olfr705 UTSW 7 106714701 splice site probably benign
R0536:Olfr705 UTSW 7 106714321 missense probably damaging 1.00
R0633:Olfr705 UTSW 7 106713977 missense probably benign 0.03
R0686:Olfr705 UTSW 7 106714378 missense probably damaging 0.98
R1225:Olfr705 UTSW 7 106714524 missense probably benign 0.22
R1725:Olfr705 UTSW 7 106714058 missense probably benign
R1864:Olfr705 UTSW 7 106713823 missense possibly damaging 0.87
R2065:Olfr705 UTSW 7 106714166 missense probably benign 0.12
R2068:Olfr705 UTSW 7 106714166 missense probably benign 0.12
R2081:Olfr705 UTSW 7 106714198 missense probably benign
R4135:Olfr705 UTSW 7 106714003 missense probably damaging 1.00
R5649:Olfr705 UTSW 7 106714166 missense possibly damaging 0.89
R5858:Olfr705 UTSW 7 106873768 missense probably benign 0.01
R6083:Olfr705 UTSW 7 106873582 missense probably damaging 0.98
R7144:Olfr705 UTSW 7 106873868 missense probably damaging 1.00
R7214:Olfr705 UTSW 7 106874267 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCAAGTGTCAGTGCCAGAAACATC -3'
(R):5'- GAGTCATGCTGGGTAGCATAAGTGG -3'

Sequencing Primer
(F):5'- CTTTGAGAAGAAAATCTAGTACGGC -3'
(R):5'- TGGCTACTGATATGACCATTGAC -3'
Posted On2013-06-12