Incidental Mutation 'R5957:1110002E22Rik'
ID471215
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5957 (G1)
Quality Score175
Status Not validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138070161 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1704 (T1704A)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: T1704A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: T1704A

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184925
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y288* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 R69L probably benign Het
Cul7 G A 17: 46,657,757 G851S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H373Y probably benign Het
Ptch1 C T 13: 63,525,115 R892H probably damaging Het
Pygl A T 12: 70,199,720 M442K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R153C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGTTTGACCCCGAGACAG -3'
(R):5'- AGGTGATGCTGATGACAGGC -3'

Sequencing Primer
(F):5'- CAATACGTGGATGTGCCCATGAC -3'
(R):5'- ATGCTGATGACAGGCTTGCC -3'
Posted OnMar 31, 2017