Incidental Mutation 'R0501:Csmd1'
ID47128
Institutional Source Beutler Lab
Gene Symbol Csmd1
Ensembl Gene ENSMUSG00000060924
Gene NameCUB and Sushi multiple domains 1
Synonyms
MMRRC Submission 038696-MU
Accession Numbers

Genbank: NM_053171.2

Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location15892537-17535586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17027323 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 106 (Q106L)
Ref Sequence ENSEMBL: ENSMUSP00000080751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082104]
Predicted Effect probably damaging
Transcript: ENSMUST00000082104
AA Change: Q106L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: Q106L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CUB 32 140 1.46e-26 SMART
CCP 145 202 1.01e-11 SMART
CUB 208 312 1.05e-27 SMART
CCP 349 406 1.28e-8 SMART
CUB 411 522 2.34e-25 SMART
CCP 527 580 1.22e-14 SMART
CUB 584 692 1.61e-37 SMART
CCP 697 754 4.41e-12 SMART
CUB 758 866 6.55e-38 SMART
CCP 873 926 2.53e-12 SMART
CUB 930 1040 8.94e-22 SMART
CCP 1045 1100 7.06e-11 SMART
CUB 1104 1212 3.14e-26 SMART
CCP 1217 1273 1.18e-12 SMART
CUB 1277 1386 9.72e-32 SMART
CCP 1391 1447 2.06e-12 SMART
CUB 1451 1559 1.68e-35 SMART
CCP 1564 1621 2.53e-12 SMART
CUB 1625 1733 4.24e-14 SMART
CCP 1741 1798 9.46e-12 SMART
CUB 1802 1910 4.23e-32 SMART
CCP 1915 1970 8.23e-12 SMART
CUB 1974 2082 8.59e-33 SMART
CCP 2087 2142 6.09e-15 SMART
CUB 2146 2253 2.36e-30 SMART
CCP 2258 2315 1.1e-12 SMART
CUB 2320 2430 4.3e-24 SMART
CCP 2432 2490 2.94e-8 SMART
CCP 2495 2552 2.03e-11 SMART
CCP 2557 2617 1.22e-5 SMART
CCP 2622 2675 2.72e-12 SMART
CCP 2680 2733 5.86e-17 SMART
CCP 2738 2791 6.09e-15 SMART
CCP 2796 2854 9.1e-14 SMART
CCP 2859 2912 3.96e-14 SMART
CCP 2920 2973 4.41e-12 SMART
CCP 2978 3032 2.94e-8 SMART
CCP 3037 3092 6.59e-11 SMART
CCP 3097 3150 4.12e-12 SMART
CCP 3155 3208 7.92e-14 SMART
CCP 3216 3270 2.8e-14 SMART
CCP 3275 3330 3.78e-11 SMART
transmembrane domain 3487 3509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138348
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Csmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Csmd1 APN 8 16009297 splice site probably benign
IGL00433:Csmd1 APN 8 16231373 missense probably damaging 1.00
IGL00500:Csmd1 APN 8 15921139 missense probably damaging 1.00
IGL00666:Csmd1 APN 8 16189990 missense probably damaging 1.00
IGL00913:Csmd1 APN 8 16071287 missense probably benign 0.00
IGL01012:Csmd1 APN 8 15917341 missense probably benign 0.00
IGL01123:Csmd1 APN 8 17534928 missense possibly damaging 0.96
IGL01348:Csmd1 APN 8 15910596 missense probably damaging 0.99
IGL01444:Csmd1 APN 8 16200055 missense probably benign 0.00
IGL01530:Csmd1 APN 8 15903195 missense probably damaging 0.99
IGL01548:Csmd1 APN 8 16288646 nonsense probably null
IGL01814:Csmd1 APN 8 16501375 missense probably damaging 1.00
IGL01889:Csmd1 APN 8 15998857 missense probably damaging 1.00
IGL02055:Csmd1 APN 8 16069001 missense probably damaging 0.99
IGL02066:Csmd1 APN 8 15926594 missense probably damaging 1.00
IGL02097:Csmd1 APN 8 16211759 missense probably null 0.17
IGL02112:Csmd1 APN 8 16081705 missense probably benign 0.18
IGL02161:Csmd1 APN 8 16358412 missense probably damaging 0.97
IGL02189:Csmd1 APN 8 16271606 missense probably damaging 0.99
IGL02272:Csmd1 APN 8 16199893 missense probably damaging 0.99
IGL02292:Csmd1 APN 8 16211870 missense probably damaging 1.00
IGL02385:Csmd1 APN 8 15903275 missense probably benign 0.08
IGL02424:Csmd1 APN 8 16092326 missense probably benign 0.22
IGL02492:Csmd1 APN 8 16002597 missense probably benign 0.13
IGL02507:Csmd1 APN 8 17534976 utr 5 prime probably benign
IGL02513:Csmd1 APN 8 15999869 splice site probably benign
IGL02727:Csmd1 APN 8 16231327 missense probably damaging 1.00
IGL02728:Csmd1 APN 8 15999779 critical splice donor site probably null
IGL02852:Csmd1 APN 8 15895728 missense probably damaging 0.99
IGL02935:Csmd1 APN 8 16223334 missense probably damaging 1.00
IGL02945:Csmd1 APN 8 16271570 missense possibly damaging 0.92
IGL02959:Csmd1 APN 8 15910465 missense probably damaging 0.99
IGL03113:Csmd1 APN 8 16028698 missense probably benign
IGL03129:Csmd1 APN 8 15961521 missense probably damaging 0.99
IGL03131:Csmd1 APN 8 16088217 missense probably damaging 1.00
IGL03275:Csmd1 APN 8 16157092 missense probably benign 0.00
IGL03297:Csmd1 APN 8 16009432 nonsense probably null
I2289:Csmd1 UTSW 8 15912381 missense probably benign 0.10
IGL03055:Csmd1 UTSW 8 16095501 missense probably damaging 1.00
IGL03097:Csmd1 UTSW 8 15945127 missense probably damaging 1.00
R0037:Csmd1 UTSW 8 15917248 missense probably damaging 0.97
R0095:Csmd1 UTSW 8 16233051 missense probably damaging 1.00
R0113:Csmd1 UTSW 8 15984849 missense probably damaging 1.00
R0129:Csmd1 UTSW 8 16079942 missense possibly damaging 0.95
R0144:Csmd1 UTSW 8 16391824 missense probably benign 0.16
R0166:Csmd1 UTSW 8 16233022 missense probably benign 0.29
R0227:Csmd1 UTSW 8 16391822 missense probably benign 0.05
R0279:Csmd1 UTSW 8 16223235 missense probably damaging 0.99
R0280:Csmd1 UTSW 8 16271602 missense probably damaging 1.00
R0312:Csmd1 UTSW 8 15984760 missense probably damaging 1.00
R0355:Csmd1 UTSW 8 15918330 missense probably damaging 0.97
R0367:Csmd1 UTSW 8 15917270 missense probably damaging 1.00
R0395:Csmd1 UTSW 8 16346638 missense probably damaging 0.99
R0413:Csmd1 UTSW 8 16710514 missense probably damaging 0.97
R0457:Csmd1 UTSW 8 16501393 critical splice acceptor site probably null
R0463:Csmd1 UTSW 8 15921759 missense probably damaging 0.99
R0482:Csmd1 UTSW 8 16233101 missense probably damaging 1.00
R0505:Csmd1 UTSW 8 15992758 missense probably damaging 1.00
R0507:Csmd1 UTSW 8 16185344 splice site probably benign
R0511:Csmd1 UTSW 8 15932529 missense possibly damaging 0.80
R0555:Csmd1 UTSW 8 16185273 missense probably benign
R0580:Csmd1 UTSW 8 15910528 missense probably damaging 1.00
R0610:Csmd1 UTSW 8 15918208 missense possibly damaging 0.95
R0634:Csmd1 UTSW 8 16226391 missense probably damaging 1.00
R0666:Csmd1 UTSW 8 16069049 missense possibly damaging 0.88
R0674:Csmd1 UTSW 8 16000550 missense probably benign 0.03
R0675:Csmd1 UTSW 8 16158131 missense probably benign 0.01
R0763:Csmd1 UTSW 8 17027284 missense possibly damaging 0.67
R0781:Csmd1 UTSW 8 15921174 missense probably benign 0.35
R0862:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0864:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0925:Csmd1 UTSW 8 16710618 missense probably benign 0.29
R0926:Csmd1 UTSW 8 16033576 splice site probably null
R1005:Csmd1 UTSW 8 16288693 missense probably damaging 0.99
R1073:Csmd1 UTSW 8 16358463 splice site probably benign
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1256:Csmd1 UTSW 8 16079964 missense probably damaging 1.00
R1294:Csmd1 UTSW 8 16698036 missense probably damaging 0.99
R1375:Csmd1 UTSW 8 16463081 splice site probably null
R1447:Csmd1 UTSW 8 15925306 nonsense probably null
R1450:Csmd1 UTSW 8 15945180 critical splice acceptor site probably null
R1470:Csmd1 UTSW 8 16157204 splice site probably benign
R1580:Csmd1 UTSW 8 15925299 missense probably damaging 1.00
R1591:Csmd1 UTSW 8 15900710 missense probably damaging 0.99
R1658:Csmd1 UTSW 8 16081725 missense possibly damaging 0.69
R1678:Csmd1 UTSW 8 15918252 missense possibly damaging 0.58
R1717:Csmd1 UTSW 8 17216692 missense possibly damaging 0.58
R1735:Csmd1 UTSW 8 15932610 missense probably damaging 0.99
R1750:Csmd1 UTSW 8 15917303 missense probably damaging 0.99
R1753:Csmd1 UTSW 8 16157120 nonsense probably null
R1822:Csmd1 UTSW 8 16223326 missense probably damaging 1.00
R1875:Csmd1 UTSW 8 15929101 missense probably damaging 0.99
R1909:Csmd1 UTSW 8 15906116 missense probably damaging 1.00
R1912:Csmd1 UTSW 8 16233998 critical splice donor site probably null
R1993:Csmd1 UTSW 8 16346684 missense probably damaging 0.99
R2067:Csmd1 UTSW 8 15900782 missense probably benign
R2094:Csmd1 UTSW 8 16079978 missense probably damaging 0.99
R2119:Csmd1 UTSW 8 17216733 missense probably damaging 0.98
R2127:Csmd1 UTSW 8 15917392 missense probably damaging 1.00
R2138:Csmd1 UTSW 8 15929088 missense probably damaging 0.96
R2216:Csmd1 UTSW 8 17027339 critical splice acceptor site probably null
R2220:Csmd1 UTSW 8 15992641 missense possibly damaging 0.94
R2380:Csmd1 UTSW 8 16190087 missense probably damaging 1.00
R2471:Csmd1 UTSW 8 16211762 missense probably damaging 1.00
R2984:Csmd1 UTSW 8 15953782 missense probably damaging 1.00
R3001:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3002:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3003:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3103:Csmd1 UTSW 8 15917405 missense probably damaging 1.00
R3104:Csmd1 UTSW 8 17027231 missense probably damaging 1.00
R3620:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3621:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3748:Csmd1 UTSW 8 15906071 missense probably damaging 0.99
R3780:Csmd1 UTSW 8 16201986 missense probably damaging 1.00
R3815:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3816:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3818:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3819:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3850:Csmd1 UTSW 8 16079922 missense probably benign 0.00
R3945:Csmd1 UTSW 8 15910619 intron probably null
R3980:Csmd1 UTSW 8 15906056 nonsense probably null
R4061:Csmd1 UTSW 8 15945158 missense probably benign 0.00
R4086:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4087:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4089:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4183:Csmd1 UTSW 8 15910464 missense probably damaging 0.99
R4226:Csmd1 UTSW 8 16000490 missense probably damaging 0.99
R4454:Csmd1 UTSW 8 15945011 missense probably damaging 0.99
R4533:Csmd1 UTSW 8 15931037 splice site probably null
R4544:Csmd1 UTSW 8 16710636 missense possibly damaging 0.93
R4547:Csmd1 UTSW 8 16391797 missense possibly damaging 0.48
R4612:Csmd1 UTSW 8 15921908 splice site probably null
R4620:Csmd1 UTSW 8 16002694 critical splice acceptor site probably null
R4627:Csmd1 UTSW 8 16697917 missense probably benign 0.00
R4633:Csmd1 UTSW 8 16002620 missense probably damaging 0.99
R4646:Csmd1 UTSW 8 15932511 missense possibly damaging 0.87
R4648:Csmd1 UTSW 8 15998788 nonsense probably null
R4668:Csmd1 UTSW 8 16023891 missense possibly damaging 0.50
R4709:Csmd1 UTSW 8 16023891 missense possibly damaging 0.96
R4709:Csmd1 UTSW 8 16710506 critical splice donor site probably null
R4741:Csmd1 UTSW 8 15910447 missense probably damaging 0.99
R4774:Csmd1 UTSW 8 16009369 missense probably benign 0.11
R4793:Csmd1 UTSW 8 16088263 missense probably damaging 1.00
R4829:Csmd1 UTSW 8 16127296 missense probably damaging 1.00
R4888:Csmd1 UTSW 8 15895674 utr 3 prime probably benign
R4896:Csmd1 UTSW 8 16009439 missense probably benign 0.00
R4932:Csmd1 UTSW 8 16023765 missense probably damaging 0.99
R4944:Csmd1 UTSW 8 15998772 missense probably damaging 1.00
R4953:Csmd1 UTSW 8 16199917 missense probably damaging 0.99
R4996:Csmd1 UTSW 8 15910452 missense probably damaging 0.97
R5028:Csmd1 UTSW 8 15989090 missense probably damaging 1.00
R5146:Csmd1 UTSW 8 16196190 missense probably damaging 1.00
R5272:Csmd1 UTSW 8 16199944 missense probably damaging 0.99
R5327:Csmd1 UTSW 8 17216712 missense possibly damaging 0.94
R5399:Csmd1 UTSW 8 16710597 missense probably damaging 1.00
R5411:Csmd1 UTSW 8 15910471 missense probably damaging 1.00
R5462:Csmd1 UTSW 8 15961486 missense probably benign 0.12
R5463:Csmd1 UTSW 8 15984860 missense probably benign 0.34
R5497:Csmd1 UTSW 8 16085181 missense probably benign 0.20
R5536:Csmd1 UTSW 8 16288660 missense probably damaging 0.99
R5711:Csmd1 UTSW 8 15953703 missense probably damaging 1.00
R5730:Csmd1 UTSW 8 16185192 nonsense probably null
R5788:Csmd1 UTSW 8 16201966 missense probably damaging 1.00
R5941:Csmd1 UTSW 8 15932471 missense probably damaging 0.99
R5960:Csmd1 UTSW 8 16071416 missense possibly damaging 0.68
R5961:Csmd1 UTSW 8 16070352 missense probably damaging 0.99
R5969:Csmd1 UTSW 8 16071353 missense probably benign 0.00
R5998:Csmd1 UTSW 8 15910443 missense probably damaging 1.00
R6062:Csmd1 UTSW 8 16092305 missense possibly damaging 0.68
R6109:Csmd1 UTSW 8 16199860 missense possibly damaging 0.93
R6116:Csmd1 UTSW 8 16211850 missense probably damaging 1.00
R6143:Csmd1 UTSW 8 16088301 missense probably damaging 1.00
R6155:Csmd1 UTSW 8 15903231 missense probably benign 0.01
R6197:Csmd1 UTSW 8 15926611 missense probably benign 0.32
R6247:Csmd1 UTSW 8 16196235 missense possibly damaging 0.91
R6304:Csmd1 UTSW 8 16058674 missense probably damaging 1.00
R6317:Csmd1 UTSW 8 16710642 missense possibly damaging 0.89
R6318:Csmd1 UTSW 8 15903212 missense probably damaging 1.00
R6338:Csmd1 UTSW 8 15932492 missense possibly damaging 0.75
R6369:Csmd1 UTSW 8 17535004 start gained probably benign
R6447:Csmd1 UTSW 8 15910527 missense probably damaging 1.00
R6454:Csmd1 UTSW 8 15921150 missense probably damaging 0.99
R6494:Csmd1 UTSW 8 16211695 splice site probably null
R6614:Csmd1 UTSW 8 17216787 missense probably damaging 1.00
R6736:Csmd1 UTSW 8 16002626 missense probably damaging 0.99
R6769:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6771:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6804:Csmd1 UTSW 8 16037246 missense probably damaging 1.00
R6818:Csmd1 UTSW 8 16185327 missense probably damaging 1.00
R6863:Csmd1 UTSW 8 17534913 missense possibly damaging 0.85
R6930:Csmd1 UTSW 8 16092395 missense probably damaging 0.97
R6969:Csmd1 UTSW 8 17216789 missense possibly damaging 0.94
X0011:Csmd1 UTSW 8 16196263 missense probably damaging 1.00
X0021:Csmd1 UTSW 8 16185256 missense probably damaging 1.00
X0024:Csmd1 UTSW 8 16037218 missense probably damaging 0.99
X0028:Csmd1 UTSW 8 15915333 missense possibly damaging 0.79
Z1088:Csmd1 UTSW 8 15921875 missense possibly damaging 0.91
Z1088:Csmd1 UTSW 8 16092258 missense probably damaging 1.00
Z1088:Csmd1 UTSW 8 16189978 missense possibly damaging 0.50
Z1088:Csmd1 UTSW 8 16200058 missense probably damaging 0.97
Z1088:Csmd1 UTSW 8 16346617 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCTTCATCTGCATCTGCATCAG -3'
(R):5'- GTGCCAGATATCCTGTCACACATGG -3'

Sequencing Primer
(F):5'- tcatctgcatctgcatcAGTATCTC -3'
(R):5'- cccagcactcagaagcc -3'
Posted On2013-06-12