Incidental Mutation 'R0501:Wdr59'
ID47131
Institutional Source Beutler Lab
Gene Symbol Wdr59
Ensembl Gene ENSMUSG00000031959
Gene NameWD repeat domain 59
Synonyms5430401O09Rik
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111448797-111522092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111458947 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 841 (R841Q)
Ref Sequence ENSEMBL: ENSMUSP00000043671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034437] [ENSMUST00000038193] [ENSMUST00000211981]
Predicted Effect probably benign
Transcript: ENSMUST00000034437
AA Change: R860Q

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034437
Gene: ENSMUSG00000031959
AA Change: R860Q

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 620 632 N/A INTRINSIC
low complexity region 802 813 N/A INTRINSIC
Blast:RING 941 980 3e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000038193
AA Change: R841Q

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043671
Gene: ENSMUSG00000031959
AA Change: R841Q

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 803 814 N/A INTRINSIC
Pfam:Zn_ribbon_17 937 992 2e-14 PFAM
Pfam:zinc_ribbon_16 949 990 1.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211981
AA Change: R858Q

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Wdr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr59 APN 8 111458736 missense probably damaging 0.98
IGL01330:Wdr59 APN 8 111481933 missense possibly damaging 0.87
IGL01413:Wdr59 APN 8 111501074 missense probably benign 0.23
IGL02306:Wdr59 APN 8 111492733 missense probably damaging 1.00
IGL03027:Wdr59 APN 8 111462192 missense probably damaging 1.00
IGL03057:Wdr59 APN 8 111476118 missense probably damaging 1.00
IGL03204:Wdr59 APN 8 111485370 missense probably benign 0.05
R0056:Wdr59 UTSW 8 111480607 splice site probably benign
R0096:Wdr59 UTSW 8 111504373 missense probably damaging 1.00
R0096:Wdr59 UTSW 8 111504373 missense probably damaging 1.00
R0440:Wdr59 UTSW 8 111480540 small deletion probably benign
R0452:Wdr59 UTSW 8 111521972 missense possibly damaging 0.87
R0472:Wdr59 UTSW 8 111486997 critical splice acceptor site probably null
R0526:Wdr59 UTSW 8 111480540 small deletion probably benign
R0534:Wdr59 UTSW 8 111480540 small deletion probably benign
R0601:Wdr59 UTSW 8 111480540 small deletion probably benign
R1144:Wdr59 UTSW 8 111486944 missense probably benign 0.09
R1415:Wdr59 UTSW 8 111498596 missense probably damaging 1.00
R1571:Wdr59 UTSW 8 111451050 missense probably damaging 0.98
R1661:Wdr59 UTSW 8 111479362 missense probably damaging 1.00
R1665:Wdr59 UTSW 8 111479362 missense probably damaging 1.00
R1839:Wdr59 UTSW 8 111485340 missense probably benign
R1856:Wdr59 UTSW 8 111476181 missense probably damaging 1.00
R1872:Wdr59 UTSW 8 111459017 missense probably damaging 1.00
R1921:Wdr59 UTSW 8 111486950 nonsense probably null
R1965:Wdr59 UTSW 8 111451077 missense probably damaging 1.00
R1966:Wdr59 UTSW 8 111450903 missense possibly damaging 0.92
R1977:Wdr59 UTSW 8 111458638 missense probably benign 0.00
R2019:Wdr59 UTSW 8 111466793 missense probably damaging 1.00
R4245:Wdr59 UTSW 8 111490364 missense possibly damaging 0.63
R4471:Wdr59 UTSW 8 111466787 critical splice donor site probably null
R4820:Wdr59 UTSW 8 111480814 missense probably benign 0.19
R5198:Wdr59 UTSW 8 111481988 missense probably benign 0.00
R5540:Wdr59 UTSW 8 111485184 missense possibly damaging 0.84
R5571:Wdr59 UTSW 8 111465831 missense probably damaging 1.00
R6166:Wdr59 UTSW 8 111472661 missense probably damaging 1.00
R6732:Wdr59 UTSW 8 111501052 missense probably damaging 1.00
R6767:Wdr59 UTSW 8 111476101 missense probably damaging 1.00
R6823:Wdr59 UTSW 8 111459040 missense possibly damaging 0.95
R6841:Wdr59 UTSW 8 111496880 missense probably damaging 1.00
R6888:Wdr59 UTSW 8 111451043 missense probably benign 0.00
R6974:Wdr59 UTSW 8 111460788 missense possibly damaging 0.86
R6982:Wdr59 UTSW 8 111460813 missense probably benign 0.00
R7066:Wdr59 UTSW 8 111465845 missense probably benign 0.07
X0026:Wdr59 UTSW 8 111479340 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACAAACTTCAGCACTTCTGCTCG -3'
(R):5'- AAAGAGGACTGTAGGGCTCCATCC -3'

Sequencing Primer
(F):5'- CTTAAAGTCGTCAAACTGCTGGG -3'
(R):5'- ATCCAGTGGACACACAGTG -3'
Posted On2013-06-12