Incidental Mutation 'R5958:Slc22a22'
ID471310
Institutional Source Beutler Lab
Gene Symbol Slc22a22
Ensembl Gene ENSMUSG00000022366
Gene Namesolute carrier family 22 (organic cation transporter), member 22
SynonymsBC026439, OAT-PG
MMRRC Submission 044145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5958 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location57243767-57477625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57263536 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 46 (A46T)
Ref Sequence ENSEMBL: ENSMUSP00000105825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022995] [ENSMUST00000110196] [ENSMUST00000137764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022995
AA Change: A46T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022995
Gene: ENSMUSG00000022366
AA Change: A46T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 117 483 1.2e-26 PFAM
Pfam:Sugar_tr 144 447 1.3e-20 PFAM
Pfam:Sugar_tr 393 553 3.2e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110196
AA Change: A46T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105825
Gene: ENSMUSG00000022366
AA Change: A46T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 116 483 1.4e-26 PFAM
Pfam:Sugar_tr 145 426 1e-19 PFAM
Pfam:Sugar_tr 391 553 2.7e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137764
AA Change: A27T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123667
Gene: ENSMUSG00000022366
AA Change: A27T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency 95% (75/79)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,041,935 D616G probably damaging Het
Adam30 A G 3: 98,161,964 N243S probably damaging Het
Adck1 A G 12: 88,459,052 I417V probably benign Het
Adcy4 T C 14: 55,779,099 probably null Het
Ahctf1 A G 1: 179,746,542 probably benign Het
Ap1s3 G T 1: 79,614,243 T130K probably benign Het
Apold1 C T 6: 134,983,723 R47C probably damaging Het
Atp13a5 T C 16: 29,339,042 K197E probably damaging Het
Camk2d T G 3: 126,779,865 probably benign Het
Ccin A G 4: 43,983,854 D87G probably damaging Het
Cdan1 T C 2: 120,723,902 T889A possibly damaging Het
Cel T A 2: 28,560,945 Y102F probably damaging Het
Cma1 A C 14: 55,941,656 *248E probably null Het
Cnbd1 T C 4: 18,862,056 N378S probably benign Het
Col18a1 T A 10: 77,096,397 Y533F probably benign Het
Cpb2 T C 14: 75,283,387 I414T probably damaging Het
D430042O09Rik A G 7: 125,813,635 K358E probably benign Het
Dagla T C 19: 10,248,424 Y792C probably damaging Het
Dlgap5 T A 14: 47,413,754 E107D probably damaging Het
Dmtf1 T A 5: 9,122,415 probably benign Het
Dst A G 1: 34,186,050 K1682R probably damaging Het
Epyc A T 10: 97,649,842 H48L probably benign Het
Fam135b A G 15: 71,462,895 S817P probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxk1 T C 5: 142,456,674 V693A probably benign Het
Fuom A T 7: 140,099,898 F122I probably damaging Het
Glg1 G T 8: 111,259,104 H31Q probably benign Het
Gm13199 C T 2: 5,862,254 probably benign Het
Hdac9 G T 12: 34,373,883 Q595K probably damaging Het
Homez C T 14: 54,856,841 R119Q probably benign Het
Ifit3b A G 19: 34,611,742 H106R probably benign Het
Ift57 C T 16: 49,711,108 probably benign Het
Itk A T 11: 46,344,855 probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhdc3 A T 17: 46,675,102 V378D probably benign Het
Klhl14 A G 18: 21,565,535 I407T probably damaging Het
Meioc A T 11: 102,675,153 T476S probably benign Het
Olfm3 G A 3: 115,122,306 V276I probably damaging Het
Olfr1449 T C 19: 12,935,047 F103S probably damaging Het
Pcm1 T C 8: 41,328,979 L1972P probably damaging Het
Pcsk6 A G 7: 66,043,611 E3G probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Pik3c2a A G 7: 116,362,564 L1010S probably damaging Het
Pitpnm3 G T 11: 72,112,367 probably null Het
Prrc2b A G 2: 32,212,080 M722V possibly damaging Het
Rad18 T C 6: 112,696,642 probably benign Het
Senp6 T C 9: 80,142,294 S1036P probably damaging Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Spag6l C A 16: 16,763,021 probably null Het
Strc T C 2: 121,376,922 H656R possibly damaging Het
Tanc2 A G 11: 105,840,625 D409G probably benign Het
Thap11 A G 8: 105,856,064 H235R probably damaging Het
Thsd7a T A 6: 12,337,262 Y1252F probably benign Het
Tlr11 T G 14: 50,360,777 N73K probably damaging Het
Ttll10 T C 4: 156,036,066 probably null Het
Ubr4 A T 4: 139,455,638 N445I probably damaging Het
Ugt1a6a C T 1: 88,215,788 probably benign Het
Urb2 T C 8: 124,029,659 F702L probably benign Het
Utp14b A T 1: 78,664,942 K186* probably null Het
Utp14b A T 1: 78,664,943 K186M probably damaging Het
Vmn2r16 T A 5: 109,362,287 M512K possibly damaging Het
Vmn2r27 T A 6: 124,231,727 M20L probably benign Het
Other mutations in Slc22a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Slc22a22 APN 15 57254278 missense probably damaging 1.00
IGL01140:Slc22a22 APN 15 57263338 missense probably damaging 1.00
IGL02350:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL02357:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL03115:Slc22a22 APN 15 57263274 missense probably damaging 1.00
IGL03244:Slc22a22 APN 15 57249552 splice site probably benign
IGL03384:Slc22a22 APN 15 57254216 missense probably benign 0.01
R0371:Slc22a22 UTSW 15 57249735 missense possibly damaging 0.82
R0501:Slc22a22 UTSW 15 57249650 missense probably benign 0.16
R0684:Slc22a22 UTSW 15 57263362 missense probably benign 0.04
R0722:Slc22a22 UTSW 15 57256553 unclassified probably null
R1240:Slc22a22 UTSW 15 57250872 missense probably benign 0.02
R1472:Slc22a22 UTSW 15 57247520 missense probably benign 0.03
R2040:Slc22a22 UTSW 15 57247540 nonsense probably null
R2125:Slc22a22 UTSW 15 57254240 missense probably damaging 1.00
R3707:Slc22a22 UTSW 15 57250973 missense probably damaging 1.00
R3921:Slc22a22 UTSW 15 57256544 missense probably benign 0.07
R4184:Slc22a22 UTSW 15 57256566 nonsense probably null
R4561:Slc22a22 UTSW 15 57263385 missense probably damaging 1.00
R4626:Slc22a22 UTSW 15 57263338 missense probably damaging 1.00
R4887:Slc22a22 UTSW 15 57249752 missense probably benign 0.20
R5181:Slc22a22 UTSW 15 57255123 missense probably benign 0.08
R5486:Slc22a22 UTSW 15 57263451 missense probably damaging 0.97
R5621:Slc22a22 UTSW 15 57259151 missense probably benign 0.02
R5812:Slc22a22 UTSW 15 57256473 critical splice donor site probably null
R6517:Slc22a22 UTSW 15 57250969 missense probably benign 0.28
R6555:Slc22a22 UTSW 15 57259131 missense probably benign 0.08
R6724:Slc22a22 UTSW 15 57247532 missense probably damaging 1.00
R6744:Slc22a22 UTSW 15 57254272 missense possibly damaging 0.46
R7078:Slc22a22 UTSW 15 57263480 missense probably benign 0.01
R7085:Slc22a22 UTSW 15 57249649 missense probably benign 0.00
R7263:Slc22a22 UTSW 15 57249711 missense probably benign
R7335:Slc22a22 UTSW 15 57263375 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CATCTAGACACGGCTCAGTC -3'
(R):5'- CAGGGAAGGAATGTGCATTTTG -3'

Sequencing Primer
(F):5'- TAGACACGGCTCAGTCTCTAG -3'
(R):5'- AGGGAAGGAATGTGCATTTTGTTGAG -3'
Posted On2017-03-31