Incidental Mutation 'R5959:Cpne1'
ID471331
Institutional Source Beutler Lab
Gene Symbol Cpne1
Ensembl Gene ENSMUSG00000074643
Gene Namecopine I
Synonyms1810028N16Rik
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R5959 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156071842-156111965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156078223 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 188 (S188L)
Ref Sequence ENSEMBL: ENSMUSP00000115167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079312] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000132494] [ENSMUST00000133921] [ENSMUST00000136296] [ENSMUST00000142960] [ENSMUST00000147627] [ENSMUST00000153634] [ENSMUST00000154889] [ENSMUST00000183518] [ENSMUST00000183972] [ENSMUST00000184152] [ENSMUST00000184265] [ENSMUST00000184899]
Predicted Effect probably benign
Transcript: ENSMUST00000079312
AA Change: S212L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643
AA Change: S212L

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
AA Change: S212L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643
AA Change: S212L

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
AA Change: S212L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643
AA Change: S212L

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126513
Predicted Effect probably benign
Transcript: ENSMUST00000127956
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132494
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133921
SMART Domains Protein: ENSMUSP00000122644
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Pfam:C2 139 178 3.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136296
AA Change: S188L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643
AA Change: S188L

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140109
SMART Domains Protein: ENSMUSP00000121998
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
Pfam:Copine 1 148 2.1e-50 PFAM
Pfam:vWA-TerF-like 5 111 2.5e-7 PFAM
low complexity region 167 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142960
AA Change: S212L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643
AA Change: S212L

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142975
Predicted Effect probably benign
Transcript: ENSMUST00000147627
AA Change: S212L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643
AA Change: S212L

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147956
Predicted Effect probably benign
Transcript: ENSMUST00000153634
AA Change: S188L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643
AA Change: S188L

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154889
SMART Domains Protein: ENSMUSP00000118140
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159952
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160165
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162612
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183353
Predicted Effect probably benign
Transcript: ENSMUST00000183518
SMART Domains Protein: ENSMUSP00000139010
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 40 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183733
Predicted Effect probably benign
Transcript: ENSMUST00000183972
Predicted Effect probably benign
Transcript: ENSMUST00000184152
SMART Domains Protein: ENSMUSP00000139035
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184899
SMART Domains Protein: ENSMUSP00000139177
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 54 2e-25 BLAST
SCOP:d2u1a__ 9 68 6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184933
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Its activity is also upregulated in mouse embryos. This gene and the gene for RNA binding motif protein 12 overlap at map location 2 H2. Two alternatively spliced variants that encode the same isoform have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Cpne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Cpne1 APN 2 156077643 missense possibly damaging 0.90
IGL02291:Cpne1 APN 2 156078420 missense probably damaging 1.00
IGL02719:Cpne1 APN 2 156078217 missense probably damaging 1.00
IGL03011:Cpne1 APN 2 156077997 missense probably damaging 0.99
IGL03347:Cpne1 APN 2 156079176 missense probably damaging 1.00
johannesburg UTSW 2 156077641 missense probably damaging 1.00
FR4304:Cpne1 UTSW 2 156072025 frame shift probably null
FR4449:Cpne1 UTSW 2 156073502 intron probably benign
FR4976:Cpne1 UTSW 2 156072025 frame shift probably null
R0496:Cpne1 UTSW 2 156079419 missense probably damaging 0.99
R0735:Cpne1 UTSW 2 156078750 critical splice donor site probably null
R0792:Cpne1 UTSW 2 156077419 missense probably benign 0.00
R1874:Cpne1 UTSW 2 156078382 missense probably damaging 0.99
R2015:Cpne1 UTSW 2 156078388 missense probably damaging 1.00
R2518:Cpne1 UTSW 2 156073971 missense probably damaging 0.99
R3000:Cpne1 UTSW 2 156073422 makesense probably null
R3875:Cpne1 UTSW 2 156076282 missense probably damaging 1.00
R5021:Cpne1 UTSW 2 156098273 intron probably benign
R5385:Cpne1 UTSW 2 156074364 missense probably damaging 0.99
R5654:Cpne1 UTSW 2 156077641 missense probably damaging 1.00
R6775:Cpne1 UTSW 2 156078420 missense probably damaging 1.00
R7049:Cpne1 UTSW 2 156078807 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTGGACACATTCAAACTCAG -3'
(R):5'- TGGAAGCGCTTCTCAGTCTC -3'

Sequencing Primer
(F):5'- TTCAAACTCAGCCTAGTGGG -3'
(R):5'- CTCTGCAGCATTTCTGTGGCG -3'
Posted On2017-03-31