Incidental Mutation 'R5959:Dchs2'
ID471332
Institutional Source Beutler Lab
Gene Symbol Dchs2
Ensembl Gene ENSMUSG00000102692
Gene Namedachsous cadherin related 2
SynonymsLOC229459
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R5959 (G1)
Quality Score218
Status Not validated
Chromosome3
Chromosomal Location83127948-83357209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83325418 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 2237 (V2237I)
Ref Sequence ENSEMBL: ENSMUSP00000141425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191829]
Predicted Effect probably benign
Transcript: ENSMUST00000191829
AA Change: V2237I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141425
Gene: ENSMUSG00000102692
AA Change: V2237I

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CA 70 149 1.6e-8 SMART
CA 173 278 1.9e-9 SMART
CA 302 395 2e-33 SMART
CA 423 522 3.2e-7 SMART
CA 546 642 1.1e-29 SMART
CA 666 750 5.6e-22 SMART
CA 774 855 1.5e-8 SMART
CA 876 958 4.2e-19 SMART
CA 982 1060 3e-8 SMART
CA 1067 1168 9.3e-7 SMART
CA 1192 1271 1.1e-28 SMART
CA 1299 1379 4e-16 SMART
CA 1403 1486 6.1e-16 SMART
CA 1510 1596 3.5e-18 SMART
CA 1619 1700 4.4e-27 SMART
CA 1724 1805 6.4e-27 SMART
CA 1828 1909 4.3e-29 SMART
CA 1933 2014 3.4e-27 SMART
CA 2038 2116 4.2e-7 SMART
CA 2139 2218 2.5e-15 SMART
CA 2242 2323 2.1e-34 SMART
CA 2346 2423 3e-24 SMART
CA 2447 2525 2e-17 SMART
CA 2549 2641 9.8e-16 SMART
CA 2665 2745 2.3e-24 SMART
CA 2769 2856 5.9e-19 SMART
CA 2880 2959 1e-3 SMART
transmembrane domain 2973 2995 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Dchs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1707:Dchs2 UTSW 3 83127605 unclassified probably benign
R5857:Dchs2 UTSW 3 83270313 missense possibly damaging 0.79
R5897:Dchs2 UTSW 3 83285410 missense possibly damaging 0.95
R6007:Dchs2 UTSW 3 83346227 missense probably damaging 0.99
R6054:Dchs2 UTSW 3 83346236 missense probably benign 0.00
R6059:Dchs2 UTSW 3 83355736 missense probably benign 0.06
R6075:Dchs2 UTSW 3 83355061 missense possibly damaging 0.68
R6379:Dchs2 UTSW 3 83355146 missense probably damaging 1.00
R6393:Dchs2 UTSW 3 83129911 missense probably damaging 1.00
R6405:Dchs2 UTSW 3 83354263 missense probably benign 0.01
R6432:Dchs2 UTSW 3 83271118 missense possibly damaging 0.96
R6434:Dchs2 UTSW 3 83269270 missense probably damaging 1.00
R6561:Dchs2 UTSW 3 83129169 missense probably benign 0.04
R6798:Dchs2 UTSW 3 83348286 missense probably damaging 1.00
R6801:Dchs2 UTSW 3 83128534 missense probably benign 0.00
R6855:Dchs2 UTSW 3 83348194 missense probably benign 0.08
R6956:Dchs2 UTSW 3 83353926 missense probably benign 0.00
R7090:Dchs2 UTSW 3 83348274 missense probably benign 0.03
R7249:Dchs2 UTSW 3 83128029 nonsense probably null
R7252:Dchs2 UTSW 3 83325303 missense probably benign 0.04
R7482:Dchs2 UTSW 3 83248725 missense possibly damaging 0.68
R7487:Dchs2 UTSW 3 83356306 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGTAGAAGAGCCTGGATTGC -3'
(R):5'- TGCGATACACATGTGAGGATC -3'

Sequencing Primer
(F):5'- CTTGATTTTGAAGTCAGGAGTGAAG -3'
(R):5'- CGATACACATGTGAGGATCAATGAAG -3'
Posted On2017-03-31