Incidental Mutation 'R5959:Ahcyl2'
ID471341
Institutional Source Beutler Lab
Gene Symbol Ahcyl2
Ensembl Gene ENSMUSG00000029772
Gene NameS-adenosylhomocysteine hydrolase-like 2
Synonyms
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R5959 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29768011-29912310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29886174 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 363 (D363G)
Ref Sequence ENSEMBL: ENSMUSP00000110897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064872] [ENSMUST00000102995] [ENSMUST00000115238] [ENSMUST00000115242] [ENSMUST00000125911] [ENSMUST00000128927] [ENSMUST00000134438] [ENSMUST00000143091]
Predicted Effect probably damaging
Transcript: ENSMUST00000064872
AA Change: D258G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067638
Gene: ENSMUSG00000029772
AA Change: D258G

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102995
AA Change: D362G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100060
Gene: ENSMUSG00000029772
AA Change: D362G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 142 172 N/A INTRINSIC
AdoHcyase 186 611 4.47e-268 SMART
AdoHcyase_NAD 371 532 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115238
AA Change: D258G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110893
Gene: ENSMUSG00000029772
AA Change: D258G

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115242
AA Change: D363G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110897
Gene: ENSMUSG00000029772
AA Change: D363G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 143 173 N/A INTRINSIC
AdoHcyase 187 612 4.47e-268 SMART
AdoHcyase_NAD 372 533 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125911
AA Change: D154G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135518
Gene: ENSMUSG00000029772
AA Change: D154G

DomainStartEndE-ValueType
AdoHcyase 1 403 8.07e-243 SMART
AdoHcyase_NAD 163 324 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128927
SMART Domains Protein: ENSMUSP00000135633
Gene: ENSMUSG00000029772

DomainStartEndE-ValueType
low complexity region 39 69 N/A INTRINSIC
Pfam:AdoHcyase 82 223 3.5e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134438
SMART Domains Protein: ENSMUSP00000118790
Gene: ENSMUSG00000029772

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 56 86 N/A INTRINSIC
Pfam:AdoHcyase 99 238 1.1e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143091
SMART Domains Protein: ENSMUSP00000144873
Gene: ENSMUSG00000029772

DomainStartEndE-ValueType
Pfam:AdoHcyase 1 115 2.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149816
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Ahcyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Ahcyl2 APN 6 29880557 missense probably benign 0.03
IGL03072:Ahcyl2 APN 6 29906501 splice site probably benign
IGL03195:Ahcyl2 APN 6 29906769 splice site probably benign
R0189:Ahcyl2 UTSW 6 29891243 missense probably benign 0.32
R0395:Ahcyl2 UTSW 6 29886168 missense probably damaging 1.00
R0555:Ahcyl2 UTSW 6 29890671 critical splice acceptor site probably benign
R0924:Ahcyl2 UTSW 6 29870628 unclassified probably null
R0930:Ahcyl2 UTSW 6 29870628 unclassified probably null
R1413:Ahcyl2 UTSW 6 29768587 utr 5 prime probably benign
R1446:Ahcyl2 UTSW 6 29891240 missense probably damaging 0.96
R1822:Ahcyl2 UTSW 6 29768584 utr 5 prime probably benign
R1864:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R1865:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R3810:Ahcyl2 UTSW 6 29891261 missense probably benign 0.01
R4429:Ahcyl2 UTSW 6 29894875 missense probably damaging 1.00
R4932:Ahcyl2 UTSW 6 29890701 missense probably benign 0.22
R5019:Ahcyl2 UTSW 6 29859739 missense possibly damaging 0.96
R5032:Ahcyl2 UTSW 6 29768556 utr 5 prime probably benign
R5396:Ahcyl2 UTSW 6 29859698 intron probably benign
R5604:Ahcyl2 UTSW 6 29908367 missense probably damaging 1.00
R5817:Ahcyl2 UTSW 6 29890721 missense probably damaging 1.00
R6159:Ahcyl2 UTSW 6 29908458 missense possibly damaging 0.81
R6531:Ahcyl2 UTSW 6 29886162 missense probably benign 0.41
R7025:Ahcyl2 UTSW 6 29908421 missense probably damaging 1.00
R7478:Ahcyl2 UTSW 6 29903267 missense probably damaging 1.00
R7560:Ahcyl2 UTSW 6 29886140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTATTGCCAGGCTGGATAC -3'
(R):5'- AGGTTACACAGTTCTGGGTG -3'

Sequencing Primer
(F):5'- TCTCTGTATCTGTCTTGTAGGATG -3'
(R):5'- GTGTGATGTGGTTAAACATGAAAC -3'
Posted On2017-03-31