Incidental Mutation 'R5959:Vmn1r49'
ID471345
Institutional Source Beutler Lab
Gene Symbol Vmn1r49
Ensembl Gene ENSMUSG00000095932
Gene Namevomeronasal 1, receptor 49
SynonymsVRi2, V1rb2, V1r5
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5959 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location90071893-90078506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90072804 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 72 (D72G)
Ref Sequence ENSEMBL: ENSMUSP00000154456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071865] [ENSMUST00000203791] [ENSMUST00000226368]
Predicted Effect probably damaging
Transcript: ENSMUST00000071865
AA Change: D72G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071762
Gene: ENSMUSG00000095932
AA Change: D72G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 5e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203791
AA Change: D72G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145107
Gene: ENSMUSG00000095932
AA Change: D72G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 5e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226368
AA Change: D72G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a non-functional knock-in allele display abnormal patterns of axonal projections in the accessory olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Vmn1r49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Vmn1r49 APN 6 90072412 missense probably damaging 0.99
IGL03230:Vmn1r49 APN 6 90072668 missense probably damaging 1.00
IGL03308:Vmn1r49 APN 6 90072359 missense possibly damaging 0.67
R0517:Vmn1r49 UTSW 6 90072738 missense probably damaging 0.98
R0638:Vmn1r49 UTSW 6 90072666 missense possibly damaging 0.95
R1498:Vmn1r49 UTSW 6 90072316 missense probably damaging 1.00
R1649:Vmn1r49 UTSW 6 90072641 missense possibly damaging 0.66
R1668:Vmn1r49 UTSW 6 90072782 missense probably benign 0.07
R1816:Vmn1r49 UTSW 6 90072803 missense possibly damaging 0.93
R2071:Vmn1r49 UTSW 6 90072202 missense probably benign 0.00
R2155:Vmn1r49 UTSW 6 90072459 missense probably damaging 0.99
R2274:Vmn1r49 UTSW 6 90072144 missense probably benign 0.23
R4222:Vmn1r49 UTSW 6 90072246 missense probably benign 0.06
R4614:Vmn1r49 UTSW 6 90072552 missense probably benign 0.00
R4797:Vmn1r49 UTSW 6 90072630 missense probably benign 0.13
R4978:Vmn1r49 UTSW 6 90072890 missense probably benign 0.30
R5227:Vmn1r49 UTSW 6 90072771 missense probably benign 0.00
R6741:Vmn1r49 UTSW 6 90072213 missense probably benign 0.19
R6744:Vmn1r49 UTSW 6 90072202 missense probably benign 0.00
R7173:Vmn1r49 UTSW 6 90072268 missense possibly damaging 0.96
R7457:Vmn1r49 UTSW 6 90072552 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCACCTGAGATGTGATGG -3'
(R):5'- GTGAACAAGGCCATGTTTTGTAAG -3'

Sequencing Primer
(F):5'- CCTGAGATGTGATGGGGAGATTTATG -3'
(R):5'- TGCTTCCTACCTACATACAATGAG -3'
Posted On2017-03-31