Incidental Mutation 'R5959:Myt1l'
ID471368
Institutional Source Beutler Lab
Gene Symbol Myt1l
Ensembl Gene ENSMUSG00000061911
Gene Namemyelin transcription factor 1-like
SynonymsC630034G21Rik, Nztf1, 2900046C06Rik, 2900093J19Rik, Png-1, Pmng1
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5959 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location29528384-29923213 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 29920040 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021009] [ENSMUST00000021009] [ENSMUST00000049784] [ENSMUST00000218583]
Predicted Effect probably null
Transcript: ENSMUST00000021009
SMART Domains Protein: ENSMUSP00000021009
Gene: ENSMUSG00000061911

DomainStartEndE-ValueType
Pfam:zf-C2HC 28 58 8.3e-19 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 502 532 1.1e-16 PFAM
Pfam:zf-C2HC 546 576 4e-18 PFAM
Pfam:MYT1 620 872 2.7e-135 PFAM
Pfam:zf-C2HC 901 931 8.4e-20 PFAM
Pfam:zf-C2HC 950 980 1.2e-18 PFAM
Pfam:zf-C2HC 1003 1033 1.1e-17 PFAM
coiled coil region 1055 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000021009
SMART Domains Protein: ENSMUSP00000021009
Gene: ENSMUSG00000061911

DomainStartEndE-ValueType
Pfam:zf-C2HC 28 58 8.3e-19 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 502 532 1.1e-16 PFAM
Pfam:zf-C2HC 546 576 4e-18 PFAM
Pfam:MYT1 620 872 2.7e-135 PFAM
Pfam:zf-C2HC 901 931 8.4e-20 PFAM
Pfam:zf-C2HC 950 980 1.2e-18 PFAM
Pfam:zf-C2HC 1003 1033 1.1e-17 PFAM
coiled coil region 1055 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000049784
SMART Domains Protein: ENSMUSP00000058264
Gene: ENSMUSG00000061911

DomainStartEndE-ValueType
Pfam:zf-C2HC 30 58 5.1e-18 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 506 533 9.9e-15 PFAM
Pfam:zf-C2HC 550 578 2.4e-16 PFAM
Pfam:MYT1 622 873 2.7e-122 PFAM
Pfam:zf-C2HC 905 933 6.3e-19 PFAM
Pfam:zf-C2HC 954 982 1.6e-18 PFAM
Pfam:zf-C2HC 1007 1035 1.4e-16 PFAM
coiled coil region 1057 1132 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218583
Predicted Effect probably null
Transcript: ENSMUST00000219744
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger superfamily of transcription factors. The encoded protein belongs to a novel class of cystein-cystein-histidine-cystein zinc finger proteins that function in the developing mammalian central nervous system. Forced expression of this gene in combination with the basic helix-loop-helix transcription factor NeuroD1 and the transcription factors POU class 3 homeobox 2 and achaete-scute family basic helix-loop-helix transcription factor 1 can convert fetal and postnatal human fibroblasts into induced neuronal cells, which are able to generate action potentials. Mutations in this gene have been associated with autosomal mental retardation-39 and autism spectrum disorder. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Myt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Myt1l APN 12 29827424 missense unknown
IGL00896:Myt1l APN 12 29826886 missense unknown
IGL01653:Myt1l APN 12 29910771 missense unknown
IGL02632:Myt1l APN 12 29914293 missense unknown
IGL03088:Myt1l APN 12 29920477 missense probably benign 0.03
IGL03212:Myt1l APN 12 29827820 missense unknown
R0057:Myt1l UTSW 12 29842612 splice site probably null
R0126:Myt1l UTSW 12 29851720 missense possibly damaging 0.91
R0356:Myt1l UTSW 12 29811501 missense unknown
R0538:Myt1l UTSW 12 29842571 missense possibly damaging 0.47
R0587:Myt1l UTSW 12 29811635 missense unknown
R0629:Myt1l UTSW 12 29811485 missense unknown
R0709:Myt1l UTSW 12 29827733 missense unknown
R0736:Myt1l UTSW 12 29827814 missense unknown
R0920:Myt1l UTSW 12 29886139 missense unknown
R1618:Myt1l UTSW 12 29827397 missense unknown
R1660:Myt1l UTSW 12 29895273 missense unknown
R1716:Myt1l UTSW 12 29811538 missense unknown
R1758:Myt1l UTSW 12 29827242 missense unknown
R1852:Myt1l UTSW 12 29851661 missense probably benign 0.27
R1971:Myt1l UTSW 12 29827092 missense unknown
R2120:Myt1l UTSW 12 29783619 critical splice acceptor site probably null
R2227:Myt1l UTSW 12 29826970 missense unknown
R2865:Myt1l UTSW 12 29910789 missense probably benign 0.00
R4587:Myt1l UTSW 12 29910801 missense unknown
R4603:Myt1l UTSW 12 29842540 missense probably benign 0.01
R4659:Myt1l UTSW 12 29849457 missense probably damaging 0.98
R4734:Myt1l UTSW 12 29919926 missense possibly damaging 0.90
R4786:Myt1l UTSW 12 29811458 missense unknown
R4824:Myt1l UTSW 12 29849400 missense probably benign 0.02
R4835:Myt1l UTSW 12 29895305 missense unknown
R4888:Myt1l UTSW 12 29886139 missense unknown
R4976:Myt1l UTSW 12 29832303 missense unknown
R4980:Myt1l UTSW 12 29827039 missense unknown
R5119:Myt1l UTSW 12 29832303 missense unknown
R5194:Myt1l UTSW 12 29811648 missense unknown
R5247:Myt1l UTSW 12 29832332 missense unknown
R5249:Myt1l UTSW 12 29832332 missense unknown
R5427:Myt1l UTSW 12 29832332 missense unknown
R5428:Myt1l UTSW 12 29832332 missense unknown
R5429:Myt1l UTSW 12 29832332 missense unknown
R5431:Myt1l UTSW 12 29832332 missense unknown
R5628:Myt1l UTSW 12 29811621 missense unknown
R5926:Myt1l UTSW 12 29832332 missense unknown
R6082:Myt1l UTSW 12 29832332 missense unknown
R6082:Myt1l UTSW 12 29842519 missense probably damaging 1.00
R6084:Myt1l UTSW 12 29832332 missense unknown
R6086:Myt1l UTSW 12 29832332 missense unknown
R6145:Myt1l UTSW 12 29832381 missense unknown
R6293:Myt1l UTSW 12 29827628 missense unknown
R6315:Myt1l UTSW 12 29827798 missense unknown
R6458:Myt1l UTSW 12 29895299 missense unknown
R6490:Myt1l UTSW 12 29832366 missense unknown
R6758:Myt1l UTSW 12 29842600 missense possibly damaging 0.94
R7230:Myt1l UTSW 12 29783874 missense probably damaging 0.99
R7330:Myt1l UTSW 12 29851554 missense unknown
U24488:Myt1l UTSW 12 29826896 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAAGCTTCTGTCCTTGTCC -3'
(R):5'- CACACTTAACGTTATGCGATCAG -3'

Sequencing Primer
(F):5'- AGCCAACCTCATGTTACATGTC -3'
(R):5'- AGCCCCACCAATGTTTCTAGTGG -3'
Posted On2017-03-31