Incidental Mutation 'R5959:Cnmd'
ID471375
Institutional Source Beutler Lab
Gene Symbol Cnmd
Ensembl Gene ENSMUSG00000022025
Gene Namechondromodulin
SynonymsChondromodulin 1, Bricd3, ChM-I
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5959 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location79637690-79662170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79656669 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 93 (I93V)
Ref Sequence ENSEMBL: ENSMUSP00000126958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022603] [ENSMUST00000165835]
Predicted Effect probably damaging
Transcript: ENSMUST00000022603
AA Change: I93V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022603
Gene: ENSMUSG00000022025
AA Change: I93V

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165835
AA Change: I93V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126958
Gene: ENSMUSG00000022025
AA Change: I93V

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphologic defects. While cartilage development and embryonic endochondral bone formation were found to be normal in mutant mice, one line of targeted mutants showed increased bone density and impairedbone resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Cnmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cnmd APN 14 79642068 splice site probably benign
IGL02556:Cnmd APN 14 79661960 missense probably benign 0.00
IGL03034:Cnmd APN 14 79641928 missense probably benign
R0529:Cnmd UTSW 14 79642041 missense probably benign 0.00
R0811:Cnmd UTSW 14 79661423 missense probably damaging 1.00
R0812:Cnmd UTSW 14 79661423 missense probably damaging 1.00
R0844:Cnmd UTSW 14 79641951 missense probably benign 0.37
R2401:Cnmd UTSW 14 79656605 missense probably damaging 0.98
R2419:Cnmd UTSW 14 79638048 missense probably damaging 1.00
R3697:Cnmd UTSW 14 79637981 missense probably damaging 1.00
R4640:Cnmd UTSW 14 79656653 missense probably damaging 1.00
R4841:Cnmd UTSW 14 79650322 missense possibly damaging 0.94
R4845:Cnmd UTSW 14 79662008 missense probably benign
R5157:Cnmd UTSW 14 79656686 missense probably benign 0.39
R6033:Cnmd UTSW 14 79661505 missense probably benign 0.00
R6033:Cnmd UTSW 14 79661505 missense probably benign 0.00
R7421:Cnmd UTSW 14 79645507 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CGAGAAGCTGCTGTTGAGAAC -3'
(R):5'- TAGCTGACTGGTATATGGATAGATTCC -3'

Sequencing Primer
(F):5'- AGTAACCACTGCGTGCGTG -3'
(R):5'- TCCTCACATATTGTGGACC -3'
Posted On2017-03-31