Incidental Mutation 'R5959:Gramd4'
ID471376
Institutional Source Beutler Lab
Gene Symbol Gramd4
Ensembl Gene ENSMUSG00000035900
Gene NameGRAM domain containing 4
Synonyms
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5959 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location86057695-86137634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86127557 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 272 (M272K)
Ref Sequence ENSEMBL: ENSMUSP00000120796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088931
AA Change: M297K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900
AA Change: M297K

DomainStartEndE-ValueType
coiled coil region 132 190 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
GRAM 500 578 8.41e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123349
AA Change: M272K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900
AA Change: M272K

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138134
AA Change: M272K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900
AA Change: M272K

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Gramd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Gramd4 APN 15 86127018 missense probably damaging 0.97
Grasping UTSW 15 86091503 missense probably damaging 0.99
R0053:Gramd4 UTSW 15 86130138 splice site probably benign
R0622:Gramd4 UTSW 15 86091389 missense probably damaging 1.00
R1401:Gramd4 UTSW 15 86125196 missense probably damaging 1.00
R1741:Gramd4 UTSW 15 86091529 splice site probably null
R1840:Gramd4 UTSW 15 86130192 critical splice donor site probably null
R1968:Gramd4 UTSW 15 86132905 missense probably damaging 1.00
R2909:Gramd4 UTSW 15 86122183 nonsense probably null
R4345:Gramd4 UTSW 15 86134893 missense probably damaging 1.00
R4431:Gramd4 UTSW 15 86130160 missense probably damaging 1.00
R4832:Gramd4 UTSW 15 86134856 missense probably benign
R5164:Gramd4 UTSW 15 86100831 missense probably benign 0.16
R5216:Gramd4 UTSW 15 86134785 critical splice acceptor site probably null
R5898:Gramd4 UTSW 15 86100784 missense probably damaging 1.00
R6303:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6304:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6678:Gramd4 UTSW 15 86091503 missense probably damaging 0.99
R6678:Gramd4 UTSW 15 86091504 missense possibly damaging 0.52
R6980:Gramd4 UTSW 15 86131969 missense probably benign 0.17
R7371:Gramd4 UTSW 15 86135406 missense probably benign 0.04
R7557:Gramd4 UTSW 15 86100900 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAGCATCCCTGTCTGTTG -3'
(R):5'- AGCTTGTGTCGCAACAGTATG -3'

Sequencing Primer
(F):5'- GGAGCTCTCTCTTAAACTGGAAGC -3'
(R):5'- TATGGAGAAGCAGGCCACCC -3'
Posted On2017-03-31