Incidental Mutation 'R5960:Synm'
ID471401
Institutional Source Beutler Lab
Gene Symbol Synm
Ensembl Gene ENSMUSG00000030554
Gene Namesynemin, intermediate filament protein
Synonyms4930412K21Rik, Dmn, Synemin
MMRRC Submission 044147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R5960 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location67730160-67759742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67735746 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 281 (S281P)
Ref Sequence ENSEMBL: ENSMUSP00000146510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051389] [ENSMUST00000074233] [ENSMUST00000207102] [ENSMUST00000208231] [ENSMUST00000208815]
Predicted Effect probably damaging
Transcript: ENSMUST00000051389
AA Change: S723P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050987
Gene: ENSMUSG00000030554
AA Change: S723P

DomainStartEndE-ValueType
Pfam:Filament 10 321 2.7e-38 PFAM
low complexity region 1248 1257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074233
AA Change: S723P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073855
Gene: ENSMUSG00000030554
AA Change: S723P

DomainStartEndE-ValueType
Filament 10 321 6.4e-38 SMART
internal_repeat_1 1089 1185 3.03e-7 PROSPERO
internal_repeat_1 1351 1454 3.03e-7 PROSPERO
low complexity region 1550 1559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207102
AA Change: S281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208231
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Predicted Effect probably benign
Transcript: ENSMUST00000208815
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intermediate filament (IF) family member. IF proteins are cytoskeletal proteins that confer resistance to mechanical stress and are encoded by a dispersed multigene family. This protein has been found to form a linkage between desmin, which is a subunit of the IF network, and the extracellular matrix, and provides an important structural support in muscle. Two alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a mild skeletal muscle phenotype characterized by abnormal muscle fiber morphology and increased sarcolemmal deformability and susceptibility to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,240,273 R22Q probably damaging Het
4930579F01Rik T C 3: 138,183,767 T30A possibly damaging Het
4931408C20Rik T A 1: 26,683,144 H985L probably benign Het
Adat1 T C 8: 111,982,601 M197V probably benign Het
Alcam T C 16: 52,295,126 T210A probably benign Het
Ankfy1 T A 11: 72,757,352 S886R possibly damaging Het
Atg2a T G 19: 6,254,360 F1136V probably damaging Het
BC049352 T C 9: 45,242,990 Y50H probably damaging Het
Birc6 A T 17: 74,528,765 T72S probably damaging Het
C77080 A G 4: 129,222,072 V933A probably damaging Het
Caskin1 A G 17: 24,498,895 T219A probably benign Het
Catsperg1 A G 7: 29,184,783 probably benign Het
Cdh12 A G 15: 21,492,476 probably null Het
Cfap126 A G 1: 171,125,313 D45G probably damaging Het
Ciz1 C A 2: 32,371,216 Q356K possibly damaging Het
Ckmt1 T A 2: 121,363,577 I407N probably damaging Het
Csmd1 C T 8: 16,071,416 E1756K possibly damaging Het
Cwf19l2 A G 9: 3,411,404 K94E probably benign Het
Cyth1 A G 11: 118,132,367 probably benign Het
Ddx25 A G 9: 35,554,511 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock3 C A 9: 106,911,355 G138* probably null Het
Fam20a G A 11: 109,675,969 probably benign Het
Fanci A G 7: 79,443,762 T1006A probably damaging Het
Fat1 T C 8: 45,033,368 Y3320H probably damaging Het
Fndc8 A G 11: 82,897,572 D76G probably benign Het
Gm19965 T C 1: 116,821,471 I294T possibly damaging Het
Gm9755 T G 8: 67,515,188 noncoding transcript Het
Iars T C 13: 49,724,637 V879A possibly damaging Het
Ifi209 A T 1: 173,638,816 probably null Het
Itgb2l T C 16: 96,426,259 H528R probably benign Het
Marf1 T C 16: 14,152,417 Q146R probably damaging Het
Megf11 A G 9: 64,660,449 T407A probably benign Het
Mtg1 T C 7: 140,146,993 probably benign Het
Nhsl1 T G 10: 18,526,976 S1317A probably benign Het
Nudt16 A T 9: 105,131,499 C63S possibly damaging Het
Nup107 T C 10: 117,790,010 I49V probably null Het
Olfr1025-ps1 T A 2: 85,918,725 S267T probably benign Het
Olfr645 G T 7: 104,084,353 N242K probably damaging Het
Orc1 T C 4: 108,606,298 S671P possibly damaging Het
Paox A G 7: 140,132,489 D211G probably benign Het
Pck2 A G 14: 55,548,547 T571A possibly damaging Het
Pigg A G 5: 108,336,294 E469G probably benign Het
Pikfyve C A 1: 65,253,438 Y1349* probably null Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Prpf40b G T 15: 99,314,904 R627L probably damaging Het
Rasgrf1 A G 9: 90,021,384 I1217V possibly damaging Het
Rbm26 A T 14: 105,150,315 V457D probably damaging Het
Rex1bd C A 8: 70,506,506 R49L probably null Het
Robo2 A T 16: 73,933,715 L1003Q probably damaging Het
Sacs A G 14: 61,208,695 D2730G probably benign Het
Setd6 T A 8: 95,716,199 L88H probably damaging Het
Sncb A G 13: 54,762,982 probably benign Het
Stard9 A G 2: 120,699,961 E2233G probably benign Het
Susd2 C T 10: 75,639,936 V410I probably damaging Het
Syvn1 C T 19: 6,050,568 R330C probably damaging Het
Theg T G 10: 79,585,931 K151T possibly damaging Het
Tiam2 A T 17: 3,438,640 D741V probably benign Het
Tph1 A G 7: 46,662,005 probably null Het
Trav7-5 T A 14: 53,531,249 H91Q probably benign Het
Tymp A T 15: 89,376,575 probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Other mutations in Synm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Synm APN 7 67734915 missense probably benign 0.01
IGL01567:Synm APN 7 67735232 missense probably damaging 0.99
IGL01867:Synm APN 7 67733474 missense probably benign 0.13
IGL01870:Synm APN 7 67736118 missense possibly damaging 0.86
IGL01951:Synm APN 7 67739137 missense probably damaging 1.00
IGL02264:Synm APN 7 67734396 missense probably damaging 0.99
IGL02892:Synm APN 7 67735056 missense probably damaging 1.00
PIT4449001:Synm UTSW 7 67735277 missense probably benign
R0032:Synm UTSW 7 67733927 missense possibly damaging 0.90
R0194:Synm UTSW 7 67734924 missense probably damaging 1.00
R0345:Synm UTSW 7 67735821 missense probably benign 0.13
R0453:Synm UTSW 7 67736882 missense possibly damaging 0.92
R0646:Synm UTSW 7 67759168 missense probably benign 0.07
R0847:Synm UTSW 7 67735056 missense probably damaging 1.00
R0919:Synm UTSW 7 67735347 missense probably damaging 1.00
R1484:Synm UTSW 7 67736332 missense probably damaging 1.00
R1700:Synm UTSW 7 67759628 start codon destroyed probably null 0.98
R1715:Synm UTSW 7 67736303 missense probably damaging 1.00
R1796:Synm UTSW 7 67734000 missense possibly damaging 0.77
R1799:Synm UTSW 7 67735959 missense probably damaging 1.00
R2116:Synm UTSW 7 67733595 missense probably benign 0.18
R2979:Synm UTSW 7 67736260 missense probably damaging 1.00
R4116:Synm UTSW 7 67734657 missense possibly damaging 0.50
R4172:Synm UTSW 7 67735361 missense probably damaging 1.00
R4981:Synm UTSW 7 67734487 missense probably benign 0.02
R5114:Synm UTSW 7 67735658 missense probably damaging 1.00
R5276:Synm UTSW 7 67734689 missense probably benign 0.08
R5446:Synm UTSW 7 67735974 missense probably benign 0.17
R5592:Synm UTSW 7 67759516 missense probably damaging 1.00
R6025:Synm UTSW 7 67734938 missense possibly damaging 0.78
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6445:Synm UTSW 7 67733645 missense probably benign
R6446:Synm UTSW 7 67734966 missense probably damaging 1.00
R6492:Synm UTSW 7 67736061 missense probably benign 0.00
R6526:Synm UTSW 7 67735583 missense possibly damaging 0.62
R6612:Synm UTSW 7 67733516 missense probably damaging 0.99
R6646:Synm UTSW 7 67735127 missense probably damaging 1.00
R6708:Synm UTSW 7 67733246 missense possibly damaging 0.72
R6957:Synm UTSW 7 67736100 missense probably benign 0.28
R6988:Synm UTSW 7 67733658 missense probably damaging 1.00
Z1088:Synm UTSW 7 67751886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAATGCCATGTGGGTCTC -3'
(R):5'- GGACACAAAGGTCACTTATGTGG -3'

Sequencing Primer
(F):5'- TCCTCCACAAAGCCCTTGGG -3'
(R):5'- CACTTATGTGGACAGGAAAGAGTTTC -3'
Posted On2017-03-31