Incidental Mutation 'R5960:Sacs'
ID471431
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R5960 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61208695 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2730 (D2730G)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119943
AA Change: D2730G

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: D2730G

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150222
Meta Mutation Damage Score 0.35 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,240,273 R22Q probably damaging Het
4930579F01Rik T C 3: 138,183,767 T30A possibly damaging Het
4931408C20Rik T A 1: 26,683,144 H985L probably benign Het
Adat1 T C 8: 111,982,601 M197V probably benign Het
Alcam T C 16: 52,295,126 T210A probably benign Het
Ankfy1 T A 11: 72,757,352 S886R possibly damaging Het
Atg2a T G 19: 6,254,360 F1136V probably damaging Het
BC049352 T C 9: 45,242,990 Y50H probably damaging Het
Birc6 A T 17: 74,528,765 T72S probably damaging Het
C77080 A G 4: 129,222,072 V933A probably damaging Het
Caskin1 A G 17: 24,498,895 T219A probably benign Het
Catsperg1 A G 7: 29,184,783 probably benign Het
Cdh12 A G 15: 21,492,476 probably null Het
Cfap126 A G 1: 171,125,313 D45G probably damaging Het
Ciz1 C A 2: 32,371,216 Q356K possibly damaging Het
Ckmt1 T A 2: 121,363,577 I407N probably damaging Het
Csmd1 C T 8: 16,071,416 E1756K possibly damaging Het
Cwf19l2 A G 9: 3,411,404 K94E probably benign Het
Cyth1 A G 11: 118,132,367 probably benign Het
Ddx25 A G 9: 35,554,511 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock3 C A 9: 106,911,355 G138* probably null Het
Fam20a G A 11: 109,675,969 probably benign Het
Fanci A G 7: 79,443,762 T1006A probably damaging Het
Fat1 T C 8: 45,033,368 Y3320H probably damaging Het
Fndc8 A G 11: 82,897,572 D76G probably benign Het
Gm19965 T C 1: 116,821,471 I294T possibly damaging Het
Gm9755 T G 8: 67,515,188 noncoding transcript Het
Iars T C 13: 49,724,637 V879A possibly damaging Het
Ifi209 A T 1: 173,638,816 probably null Het
Itgb2l T C 16: 96,426,259 H528R probably benign Het
Marf1 T C 16: 14,152,417 Q146R probably damaging Het
Megf11 A G 9: 64,660,449 T407A probably benign Het
Mtg1 T C 7: 140,146,993 probably benign Het
Nhsl1 T G 10: 18,526,976 S1317A probably benign Het
Nudt16 A T 9: 105,131,499 C63S possibly damaging Het
Nup107 T C 10: 117,790,010 I49V probably null Het
Olfr1025-ps1 T A 2: 85,918,725 S267T probably benign Het
Olfr645 G T 7: 104,084,353 N242K probably damaging Het
Orc1 T C 4: 108,606,298 S671P possibly damaging Het
Paox A G 7: 140,132,489 D211G probably benign Het
Pck2 A G 14: 55,548,547 T571A possibly damaging Het
Pigg A G 5: 108,336,294 E469G probably benign Het
Pikfyve C A 1: 65,253,438 Y1349* probably null Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Prpf40b G T 15: 99,314,904 R627L probably damaging Het
Rasgrf1 A G 9: 90,021,384 I1217V possibly damaging Het
Rbm26 A T 14: 105,150,315 V457D probably damaging Het
Rex1bd C A 8: 70,506,506 R49L probably null Het
Robo2 A T 16: 73,933,715 L1003Q probably damaging Het
Setd6 T A 8: 95,716,199 L88H probably damaging Het
Sncb A G 13: 54,762,982 probably benign Het
Stard9 A G 2: 120,699,961 E2233G probably benign Het
Susd2 C T 10: 75,639,936 V410I probably damaging Het
Synm A G 7: 67,735,746 S281P probably damaging Het
Syvn1 C T 19: 6,050,568 R330C probably damaging Het
Theg T G 10: 79,585,931 K151T possibly damaging Het
Tiam2 A T 17: 3,438,640 D741V probably benign Het
Tph1 A G 7: 46,662,005 probably null Het
Trav7-5 T A 14: 53,531,249 H91Q probably benign Het
Tymp A T 15: 89,376,575 probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGCCAGATATGCACCAG -3'
(R):5'- ACAGAGGCGTGGAATTGCTTC -3'

Sequencing Primer
(F):5'- AGCCCTGGACGCATGTTTAGAG -3'
(R):5'- GGAATTGCTTCCTTTTCAATCGG -3'
Posted On2017-03-31