Incidental Mutation 'R5972:Fam189b'
ID471449
Institutional Source Beutler Lab
Gene Symbol Fam189b
Ensembl Gene ENSMUSG00000032657
Gene Namefamily with sequence similarity 189, member B
Synonyms1110013L07Rik
MMRRC Submission 044155-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5972 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89183143-89189295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89185808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 213 (V213D)
Ref Sequence ENSEMBL: ENSMUSP00000113579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029684] [ENSMUST00000041913] [ENSMUST00000098941] [ENSMUST00000117278] [ENSMUST00000119707] [ENSMUST00000120697] [ENSMUST00000127982] [ENSMUST00000140473] [ENSMUST00000147696]
Predicted Effect probably benign
Transcript: ENSMUST00000029684
SMART Domains Protein: ENSMUSP00000029684
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 310 1.5e-76 PFAM
low complexity region 329 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041913
AA Change: V291D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039261
Gene: ENSMUSG00000032657
AA Change: V291D

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 8e-36 PFAM
low complexity region 243 254 N/A INTRINSIC
low complexity region 390 408 N/A INTRINSIC
low complexity region 445 463 N/A INTRINSIC
low complexity region 471 490 N/A INTRINSIC
low complexity region 628 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098941
SMART Domains Protein: ENSMUSP00000096540
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 229 5.5e-46 PFAM
Pfam:SCAMP 227 276 2.2e-11 PFAM
low complexity region 295 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117278
AA Change: V272D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113706
Gene: ENSMUSG00000032657
AA Change: V272D

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
Pfam:CD20 74 177 7.3e-13 PFAM
low complexity region 224 235 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 426 444 N/A INTRINSIC
low complexity region 452 471 N/A INTRINSIC
low complexity region 609 630 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119707
AA Change: V213D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113579
Gene: ENSMUSG00000032657
AA Change: V213D

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-18 PFAM
low complexity region 312 330 N/A INTRINSIC
low complexity region 367 385 N/A INTRINSIC
low complexity region 393 412 N/A INTRINSIC
low complexity region 550 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120697
SMART Domains Protein: ENSMUSP00000112846
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 50 70 N/A INTRINSIC
coiled coil region 90 128 N/A INTRINSIC
Pfam:SCAMP 135 310 1.1e-67 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126115
Predicted Effect probably benign
Transcript: ENSMUST00000127982
SMART Domains Protein: ENSMUSP00000114855
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 77 6.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136209
Predicted Effect probably benign
Transcript: ENSMUST00000140473
Predicted Effect probably benign
Transcript: ENSMUST00000147696
SMART Domains Protein: ENSMUSP00000117185
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-30 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 324 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155033
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located near the gene for the lysosomal enzyme glucosylceramidase; a deficiency in this enzyme is associated with Gaucher disease. The encoded protein has been identified as a potential binding partner of a WW domain-containing protein which is involved in apoptosis and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,672,085 M305K probably benign Het
Accs G T 2: 93,839,227 H283N probably damaging Het
Actl6b A T 5: 137,566,556 H283L possibly damaging Het
Adgra1 T C 7: 139,845,667 L32P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgef2 T C 2: 166,891,836 I1672T probably damaging Het
Arntl2 A G 6: 146,809,689 M64V probably damaging Het
Bambi T A 18: 3,512,354 V246E probably damaging Het
BC048679 A G 7: 81,495,731 L29P probably damaging Het
Camk4 T C 18: 33,107,926 L92P probably damaging Het
Ddx11 C A 17: 66,148,090 Q655K probably benign Het
Ddx52 A G 11: 83,953,225 probably null Het
Eps8l3 T C 3: 107,884,447 probably null Het
Erap1 T A 13: 74,662,304 probably null Het
Flg T A 3: 93,279,542 N100K probably benign Het
Grip2 A T 6: 91,807,281 V13E probably benign Het
Iars T C 13: 49,709,632 V520A possibly damaging Het
Impa1 A G 3: 10,329,004 M1T probably null Het
Ip6k3 T C 17: 27,149,960 T179A possibly damaging Het
Krt83 T A 15: 101,487,586 M302L probably benign Het
Lrp8 T C 4: 107,869,070 Y899H probably damaging Het
Lrpprc A T 17: 84,712,822 I1145N possibly damaging Het
Mapk11 A T 15: 89,144,184 D324E probably benign Het
Melk C T 4: 44,351,007 T516I probably benign Het
Mia2 C T 12: 59,146,937 H130Y probably damaging Het
Mroh5 C T 15: 73,790,719 probably null Het
Ncam1 T C 9: 49,507,529 T824A possibly damaging Het
Neurog1 T C 13: 56,251,398 S179G probably damaging Het
Ntrk2 T A 13: 58,837,819 L79Q probably damaging Het
Patj T A 4: 98,569,053 M46K probably damaging Het
Pdcd6ip T C 9: 113,662,298 K626E probably benign Het
Pdss2 T A 10: 43,298,926 Y143N probably damaging Het
Pkhd1l1 G A 15: 44,545,416 S2433N probably damaging Het
Plekha5 A G 6: 140,572,913 T309A possibly damaging Het
Prdm4 C T 10: 85,907,501 V297M probably damaging Het
Rab15 T C 12: 76,800,603 Y148C probably damaging Het
Ryr3 A T 2: 112,834,064 N1627K probably damaging Het
Scn1a G T 2: 66,351,110 A23E possibly damaging Het
Smtn A T 11: 3,533,486 I30N probably damaging Het
Sympk A G 7: 19,046,824 K751E probably benign Het
Usp24 C T 4: 106,368,067 P632L probably damaging Het
Vmn2r106 A G 17: 20,278,476 I391T probably benign Het
Vmn2r54 G A 7: 12,615,352 P768S probably damaging Het
Vmn2r54 C T 7: 12,635,947 C63Y probably damaging Het
Zfhx3 T G 8: 108,950,851 C2844W possibly damaging Het
Other mutations in Fam189b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Fam189b APN 3 89188426 missense probably damaging 1.00
IGL01554:Fam189b APN 3 89185581 missense probably damaging 1.00
IGL02061:Fam189b APN 3 89188596 nonsense probably null
IGL02064:Fam189b APN 3 89188596 nonsense probably null
IGL02065:Fam189b APN 3 89188596 nonsense probably null
IGL02066:Fam189b APN 3 89188596 nonsense probably null
IGL02067:Fam189b APN 3 89188596 nonsense probably null
IGL02068:Fam189b APN 3 89188596 nonsense probably null
IGL02890:Fam189b APN 3 89186782 missense possibly damaging 0.66
R1219:Fam189b UTSW 3 89183848 missense probably damaging 0.99
R1634:Fam189b UTSW 3 89188094 missense probably damaging 1.00
R1645:Fam189b UTSW 3 89186847 missense possibly damaging 0.65
R2043:Fam189b UTSW 3 89185567 missense probably damaging 1.00
R4176:Fam189b UTSW 3 89184447 missense probably damaging 1.00
R4379:Fam189b UTSW 3 89185757 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACAAAGGTAAGGCTGGA -3'
(R):5'- GGGGCATCAGTTTCCATATCTTTAT -3'

Sequencing Primer
(F):5'- CAAAGGTAAGGCTGGAGGTGG -3'
(R):5'- GTCAGATCTCATTACAGGTGAGCC -3'
Posted On2017-03-31