Incidental Mutation 'R5972:Mia2'
ID471480
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
MMRRC Submission 044155-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R5972 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59146937 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 130 (H130Y)
Ref Sequence ENSEMBL: ENSMUSP00000135179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069430] [ENSMUST00000170992] [ENSMUST00000175877] [ENSMUST00000175912] [ENSMUST00000176322] [ENSMUST00000176336] [ENSMUST00000176464] [ENSMUST00000176727] [ENSMUST00000176752] [ENSMUST00000176892] [ENSMUST00000177162] [ENSMUST00000177225] [ENSMUST00000177370] [ENSMUST00000177460] [ENSMUST00000219140]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069430
AA Change: H154Y

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070572
Gene: ENSMUSG00000021000
AA Change: H154Y

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 124 253 9e-6 SMART
SCOP:d1fxkc_ 314 437 3e-16 SMART
low complexity region 480 493 N/A INTRINSIC
low complexity region 533 556 N/A INTRINSIC
low complexity region 682 700 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 751 775 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170992
AA Change: H132Y

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126538
Gene: ENSMUSG00000021000
AA Change: H132Y

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 102 231 2e-6 SMART
SCOP:d1fxkc_ 292 415 2e-17 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175803
Predicted Effect probably damaging
Transcript: ENSMUST00000175877
AA Change: H104Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135440
Gene: ENSMUSG00000021000
AA Change: H104Y

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d1fxkc_ 74 203 1e-5 SMART
SCOP:d1fxkc_ 264 387 6e-16 SMART
low complexity region 430 443 N/A INTRINSIC
low complexity region 589 607 N/A INTRINSIC
low complexity region 614 624 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
low complexity region 658 682 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175912
AA Change: H145Y

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135251
Gene: ENSMUSG00000021000
AA Change: H145Y

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 115 244 8e-6 SMART
SCOP:d1fxkc_ 305 428 2e-16 SMART
low complexity region 471 484 N/A INTRINSIC
low complexity region 524 547 N/A INTRINSIC
low complexity region 673 691 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 713 733 N/A INTRINSIC
low complexity region 742 766 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176322
AA Change: H165Y

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135100
Gene: ENSMUSG00000021000
AA Change: H165Y

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 135 264 4e-6 SMART
SCOP:d1fxkc_ 325 448 9e-17 SMART
low complexity region 491 504 N/A INTRINSIC
low complexity region 544 567 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 718 728 N/A INTRINSIC
low complexity region 733 753 N/A INTRINSIC
low complexity region 762 786 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176336
AA Change: H121Y

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134872
Gene: ENSMUSG00000021000
AA Change: H121Y

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
coiled coil region 55 235 N/A INTRINSIC
SCOP:d1fxkc_ 281 404 6e-8 SMART
low complexity region 447 460 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176464
AA Change: H156Y

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135390
Gene: ENSMUSG00000021000
AA Change: H156Y

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 4e-6 SMART
SCOP:d1fxkc_ 316 439 8e-17 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 535 558 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 753 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176617
Predicted Effect probably benign
Transcript: ENSMUST00000176727
SMART Domains Protein: ENSMUSP00000135694
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176752
SMART Domains Protein: ENSMUSP00000134972
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176892
AA Change: H121Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135245
Gene: ENSMUSG00000021000
AA Change: H121Y

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 91 220 4e-6 SMART
SCOP:d1fxkc_ 281 404 8e-17 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 649 667 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 718 742 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177162
AA Change: H156Y

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135001
Gene: ENSMUSG00000021000
AA Change: H156Y

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 2e-5 SMART
SCOP:d1fxkc_ 316 439 8e-16 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
low complexity region 666 676 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
low complexity region 710 734 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177225
AA Change: H128Y

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135618
Gene: ENSMUSG00000021000
AA Change: H128Y

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
SCOP:d1fxkc_ 98 227 3e-5 SMART
SCOP:d1fxkc_ 288 411 2e-15 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 613 631 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
low complexity region 653 673 N/A INTRINSIC
low complexity region 682 706 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177370
AA Change: H130Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135179
Gene: ENSMUSG00000021000
AA Change: H130Y

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
coiled coil region 95 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177460
SMART Domains Protein: ENSMUSP00000134887
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
coiled coil region 84 116 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219140
AA Change: H757Y

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,672,085 M305K probably benign Het
Accs G T 2: 93,839,227 H283N probably damaging Het
Actl6b A T 5: 137,566,556 H283L possibly damaging Het
Adgra1 T C 7: 139,845,667 L32P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgef2 T C 2: 166,891,836 I1672T probably damaging Het
Arntl2 A G 6: 146,809,689 M64V probably damaging Het
Bambi T A 18: 3,512,354 V246E probably damaging Het
BC048679 A G 7: 81,495,731 L29P probably damaging Het
Camk4 T C 18: 33,107,926 L92P probably damaging Het
Ddx11 C A 17: 66,148,090 Q655K probably benign Het
Ddx52 A G 11: 83,953,225 probably null Het
Eps8l3 T C 3: 107,884,447 probably null Het
Erap1 T A 13: 74,662,304 probably null Het
Fam189b T A 3: 89,185,808 V213D probably damaging Het
Flg T A 3: 93,279,542 N100K probably benign Het
Grip2 A T 6: 91,807,281 V13E probably benign Het
Iars T C 13: 49,709,632 V520A possibly damaging Het
Impa1 A G 3: 10,329,004 M1T probably null Het
Ip6k3 T C 17: 27,149,960 T179A possibly damaging Het
Krt83 T A 15: 101,487,586 M302L probably benign Het
Lrp8 T C 4: 107,869,070 Y899H probably damaging Het
Lrpprc A T 17: 84,712,822 I1145N possibly damaging Het
Mapk11 A T 15: 89,144,184 D324E probably benign Het
Melk C T 4: 44,351,007 T516I probably benign Het
Mroh5 C T 15: 73,790,719 probably null Het
Ncam1 T C 9: 49,507,529 T824A possibly damaging Het
Neurog1 T C 13: 56,251,398 S179G probably damaging Het
Ntrk2 T A 13: 58,837,819 L79Q probably damaging Het
Patj T A 4: 98,569,053 M46K probably damaging Het
Pdcd6ip T C 9: 113,662,298 K626E probably benign Het
Pdss2 T A 10: 43,298,926 Y143N probably damaging Het
Pkhd1l1 G A 15: 44,545,416 S2433N probably damaging Het
Plekha5 A G 6: 140,572,913 T309A possibly damaging Het
Prdm4 C T 10: 85,907,501 V297M probably damaging Het
Rab15 T C 12: 76,800,603 Y148C probably damaging Het
Ryr3 A T 2: 112,834,064 N1627K probably damaging Het
Scn1a G T 2: 66,351,110 A23E possibly damaging Het
Smtn A T 11: 3,533,486 I30N probably damaging Het
Sympk A G 7: 19,046,824 K751E probably benign Het
Usp24 C T 4: 106,368,067 P632L probably damaging Het
Vmn2r106 A G 17: 20,278,476 I391T probably benign Het
Vmn2r54 G A 7: 12,615,352 P768S probably damaging Het
Vmn2r54 C T 7: 12,635,947 C63Y probably damaging Het
Zfhx3 T G 8: 108,950,851 C2844W possibly damaging Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59101579 missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59144766 nonsense probably null
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2698:Mia2 UTSW 12 59170994 critical splice donor site probably null
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5156:Mia2 UTSW 12 59172537 missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59108370 missense probably damaging 0.97
R6695:Mia2 UTSW 12 59172580 missense probably damaging 0.99
R6800:Mia2 UTSW 12 59188546 critical splice donor site probably null
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCTCTTAGGGAAGTTGCTG -3'
(R):5'- AGAGCTAACATCTAGGCCTTCTAG -3'

Sequencing Primer
(F):5'- TGGCAACTGCTAGTCCTGC -3'
(R):5'- AGAGTTTGATTTATGCAGCCCC -3'
Posted On2017-03-31