Mutagenetix > Incidental Mutation

Incidental Mutation 'R5972:Lrpprc'

471497

Institutional Source

Beutler Lab

Gene Symbol

Lrpprc

Ensembl Gene

ENSMUSG00000024120

Gene Name

leucine-rich PPR-motif containing

Synonyms

Lrp130, 3110001K13Rik

MMRRC Submission

044155-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85012675-85098214 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85020250 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1145 (I1145N)

Ref Sequence

ENSEMBL: ENSMUSP00000107927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112308]

AlphaFold

Q6PB66

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112308
AA Change: I1145N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: I1145N

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	32	50	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Pfam:PPR_3	196	228	9.1e-4	PFAM
Pfam:PPR	197	227	2.3e-4	PFAM
Pfam:PPR_3	231	264	7.9e-6	PFAM
Pfam:PPR	232	262	4e-4	PFAM
Pfam:PPR_3	266	297	9.7e-3	PFAM
internal_repeat_2	391	477	3.13e-7	PROSPERO
Pfam:PPR	750	778	3.4e-4	PFAM
low complexity region	1017	1028	N/A	INTRINSIC
internal_repeat_1	1042	1362	1.09e-11	PROSPERO
low complexity region	1366	1375	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162799

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	T	A	6: 58,649,070 (GRCm39)	M305K	probably benign	Het
Accs	G	T	2: 93,669,572 (GRCm39)	H283N	probably damaging	Het
Actl6b	A	T	5: 137,564,818 (GRCm39)	H283L	possibly damaging	Het
Adgra1	T	C	7: 139,425,583 (GRCm39)	L32P	probably damaging	Het
Afg3l2	G	T	18: 67,554,329 (GRCm39)	L458M	probably damaging	Het
Arfgef2	T	C	2: 166,733,756 (GRCm39)	I1672T	probably damaging	Het
Bambi	T	A	18: 3,512,354 (GRCm39)	V246E	probably damaging	Het
BC048679	A	G	7: 81,145,479 (GRCm39)	L29P	probably damaging	Het
Bmal2	A	G	6: 146,711,187 (GRCm39)	M64V	probably damaging	Het
Camk4	T	C	18: 33,240,979 (GRCm39)	L92P	probably damaging	Het
Ddx11	C	A	17: 66,455,085 (GRCm39)	Q655K	probably benign	Het
Ddx52	A	G	11: 83,844,051 (GRCm39)		probably null	Het
Entrep3	T	A	3: 89,093,115 (GRCm39)	V213D	probably damaging	Het
Eps8l3	T	C	3: 107,791,763 (GRCm39)		probably null	Het
Erap1	T	A	13: 74,810,423 (GRCm39)		probably null	Het
Flg	T	A	3: 93,186,849 (GRCm39)	N100K	probably benign	Het
Grip2	A	T	6: 91,784,262 (GRCm39)	V13E	probably benign	Het
Iars1	T	C	13: 49,863,108 (GRCm39)	V520A	possibly damaging	Het
Impa1	A	G	3: 10,394,064 (GRCm39)	M1T	probably null	Het
Ip6k3	T	C	17: 27,368,934 (GRCm39)	T179A	possibly damaging	Het
Krt87	T	A	15: 101,385,467 (GRCm39)	M302L	probably benign	Het
Lrp8	T	C	4: 107,726,267 (GRCm39)	Y899H	probably damaging	Het
Mapk11	A	T	15: 89,028,387 (GRCm39)	D324E	probably benign	Het
Melk	C	T	4: 44,351,007 (GRCm39)	T516I	probably benign	Het
Mia2	C	T	12: 59,193,723 (GRCm39)	H130Y	probably damaging	Het
Mroh5	C	T	15: 73,662,568 (GRCm39)		probably null	Het
Ncam1	T	C	9: 49,418,829 (GRCm39)	T824A	possibly damaging	Het
Neurog1	T	C	13: 56,399,211 (GRCm39)	S179G	probably damaging	Het
Ntrk2	T	A	13: 58,985,633 (GRCm39)	L79Q	probably damaging	Het
Patj	T	A	4: 98,457,290 (GRCm39)	M46K	probably damaging	Het
Pdcd6ip	T	C	9: 113,491,366 (GRCm39)	K626E	probably benign	Het
Pdss2	T	A	10: 43,174,922 (GRCm39)	Y143N	probably damaging	Het
Pkhd1l1	G	A	15: 44,408,812 (GRCm39)	S2433N	probably damaging	Het
Plekha5	A	G	6: 140,518,639 (GRCm39)	T309A	possibly damaging	Het
Prdm4	C	T	10: 85,743,365 (GRCm39)	V297M	probably damaging	Het
Rab15	T	C	12: 76,847,377 (GRCm39)	Y148C	probably damaging	Het
Ryr3	A	T	2: 112,664,409 (GRCm39)	N1627K	probably damaging	Het
Scn1a	G	T	2: 66,181,454 (GRCm39)	A23E	possibly damaging	Het
Smtn	A	T	11: 3,483,486 (GRCm39)	I30N	probably damaging	Het
Sympk	A	G	7: 18,780,749 (GRCm39)	K751E	probably benign	Het
Usp24	C	T	4: 106,225,264 (GRCm39)	P632L	probably damaging	Het
Vmn2r106	A	G	17: 20,498,738 (GRCm39)	I391T	probably benign	Het
Vmn2r54	G	A	7: 12,349,279 (GRCm39)	P768S	probably damaging	Het
Vmn2r54	C	T	7: 12,369,874 (GRCm39)	C63Y	probably damaging	Het
Zfhx3	T	G	8: 109,677,483 (GRCm39)	C2844W	possibly damaging	Het

Other mutations in Lrpprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Lrpprc	APN	17	85,057,953 (GRCm39)	missense	possibly damaging	0.91
IGL01319:Lrpprc	APN	17	85,012,840 (GRCm39)	utr 3 prime	probably benign
IGL01380:Lrpprc	APN	17	85,030,158 (GRCm39)	missense	probably benign
IGL01560:Lrpprc	APN	17	85,015,547 (GRCm39)	missense	probably benign	0.07
IGL01582:Lrpprc	APN	17	85,061,971 (GRCm39)	missense	probably null	0.00
IGL01996:Lrpprc	APN	17	85,080,698 (GRCm39)	missense	probably benign
IGL02109:Lrpprc	APN	17	85,033,998 (GRCm39)	nonsense	probably null
IGL02163:Lrpprc	APN	17	85,060,900 (GRCm39)	missense	probably damaging	0.97
IGL02248:Lrpprc	APN	17	85,078,895 (GRCm39)	missense	probably damaging	0.99
IGL02503:Lrpprc	APN	17	85,033,767 (GRCm39)	missense	probably benign
IGL02545:Lrpprc	APN	17	85,082,853 (GRCm39)	missense	probably benign
IGL02570:Lrpprc	APN	17	85,057,981 (GRCm39)	missense	probably damaging	1.00
IGL02636:Lrpprc	APN	17	85,060,532 (GRCm39)	unclassified	probably benign
IGL02943:Lrpprc	APN	17	85,078,878 (GRCm39)	missense	probably benign	0.00
IGL03008:Lrpprc	APN	17	85,058,675 (GRCm39)	missense	probably benign	0.05
elusory	UTSW	17	85,020,215 (GRCm39)	missense	probably benign	0.01
phantom	UTSW	17	85,079,575 (GRCm39)	missense	probably damaging	1.00
R6807_Lrpprc_629	UTSW	17	85,056,531 (GRCm39)	missense	possibly damaging	0.93
Stereotype	UTSW	17	85,074,483 (GRCm39)	missense	probably damaging	1.00
thus	UTSW	17	85,078,355 (GRCm39)	missense	probably benign	0.01
P0023:Lrpprc	UTSW	17	85,033,766 (GRCm39)	missense	probably benign	0.00
R0027:Lrpprc	UTSW	17	85,074,435 (GRCm39)	nonsense	probably null
R0027:Lrpprc	UTSW	17	85,074,435 (GRCm39)	nonsense	probably null
R0302:Lrpprc	UTSW	17	85,047,506 (GRCm39)	missense	possibly damaging	0.76
R0389:Lrpprc	UTSW	17	85,060,540 (GRCm39)	critical splice donor site	probably null
R0448:Lrpprc	UTSW	17	85,078,322 (GRCm39)	missense	probably benign	0.09
R1396:Lrpprc	UTSW	17	85,033,731 (GRCm39)	missense	possibly damaging	0.68
R1759:Lrpprc	UTSW	17	85,047,509 (GRCm39)	missense	probably damaging	1.00
R2019:Lrpprc	UTSW	17	85,059,759 (GRCm39)	missense	possibly damaging	0.56
R2169:Lrpprc	UTSW	17	85,077,505 (GRCm39)	missense	probably benign	0.00
R2312:Lrpprc	UTSW	17	85,080,686 (GRCm39)	missense	probably damaging	0.96
R2319:Lrpprc	UTSW	17	85,033,818 (GRCm39)	missense	probably benign
R2568:Lrpprc	UTSW	17	85,034,077 (GRCm39)	missense	probably damaging	1.00
R3013:Lrpprc	UTSW	17	85,074,497 (GRCm39)	missense	probably benign	0.04
R3620:Lrpprc	UTSW	17	85,077,452 (GRCm39)	missense	probably benign	0.01
R3789:Lrpprc	UTSW	17	85,078,956 (GRCm39)	missense	probably benign	0.25
R3848:Lrpprc	UTSW	17	85,078,355 (GRCm39)	missense	probably benign	0.01
R3973:Lrpprc	UTSW	17	85,078,269 (GRCm39)	critical splice donor site	probably null
R4111:Lrpprc	UTSW	17	85,033,766 (GRCm39)	missense	probably benign	0.00
R4164:Lrpprc	UTSW	17	85,038,617 (GRCm39)	missense	possibly damaging	0.47
R4331:Lrpprc	UTSW	17	85,047,970 (GRCm39)	critical splice donor site	probably null
R4531:Lrpprc	UTSW	17	85,020,215 (GRCm39)	missense	probably benign	0.01
R4832:Lrpprc	UTSW	17	85,014,584 (GRCm39)	missense	probably benign	0.24
R4947:Lrpprc	UTSW	17	85,078,966 (GRCm39)	missense	probably benign	0.02
R5134:Lrpprc	UTSW	17	85,058,684 (GRCm39)	missense	probably benign	0.00
R5333:Lrpprc	UTSW	17	85,097,821 (GRCm39)	missense	probably benign	0.01
R5950:Lrpprc	UTSW	17	85,047,598 (GRCm39)	missense	possibly damaging	0.86
R6185:Lrpprc	UTSW	17	85,074,452 (GRCm39)	missense	probably benign
R6253:Lrpprc	UTSW	17	85,048,065 (GRCm39)	missense	probably benign	0.00
R6488:Lrpprc	UTSW	17	85,058,781 (GRCm39)	missense	probably damaging	1.00
R6807:Lrpprc	UTSW	17	85,056,531 (GRCm39)	missense	possibly damaging	0.93
R6911:Lrpprc	UTSW	17	85,063,711 (GRCm39)	missense	possibly damaging	0.67
R6933:Lrpprc	UTSW	17	85,030,131 (GRCm39)	missense	probably benign	0.42
R6955:Lrpprc	UTSW	17	85,084,417 (GRCm39)	missense	probably damaging	0.98
R7448:Lrpprc	UTSW	17	85,079,567 (GRCm39)	missense	probably damaging	0.99
R7727:Lrpprc	UTSW	17	85,084,375 (GRCm39)	missense	probably benign	0.00
R8003:Lrpprc	UTSW	17	85,059,745 (GRCm39)	missense	probably benign	0.01
R8178:Lrpprc	UTSW	17	85,079,575 (GRCm39)	missense	probably damaging	1.00
R8310:Lrpprc	UTSW	17	85,080,524 (GRCm39)	missense	probably damaging	1.00
R8322:Lrpprc	UTSW	17	85,047,496 (GRCm39)	critical splice donor site	probably null
R8389:Lrpprc	UTSW	17	85,080,742 (GRCm39)	missense	possibly damaging	0.79
R8560:Lrpprc	UTSW	17	85,047,495 (GRCm39)	splice site	probably benign
R8777:Lrpprc	UTSW	17	85,058,657 (GRCm39)	missense	probably benign	0.30
R8777-TAIL:Lrpprc	UTSW	17	85,058,657 (GRCm39)	missense	probably benign	0.30
R8868:Lrpprc	UTSW	17	85,078,920 (GRCm39)	missense	probably damaging	0.99
R8970:Lrpprc	UTSW	17	85,074,483 (GRCm39)	missense	probably damaging	1.00
R9042:Lrpprc	UTSW	17	85,059,736 (GRCm39)	critical splice donor site	probably null
R9493:Lrpprc	UTSW	17	85,015,548 (GRCm39)	missense	probably damaging	0.99
R9664:Lrpprc	UTSW	17	85,020,262 (GRCm39)	missense	probably damaging	0.99
X0026:Lrpprc	UTSW	17	85,018,090 (GRCm39)	missense	probably benign	0.42
Z1088:Lrpprc	UTSW	17	85,077,928 (GRCm39)	critical splice acceptor site	probably null
Z1088:Lrpprc	UTSW	17	85,039,212 (GRCm39)	nonsense	probably null
Z1176:Lrpprc	UTSW	17	85,077,859 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TTTTCCAAAAGACGCAAAGGAC -3'
(R):5'- TCGCACAGCACAGTCAGATG -3'

Sequencing Primer
(F):5'- CAAGAACATTTTAAAGGTGGTCATCG -3'
(R):5'- ACTTTGTAGACCAGGCTGAC -3'

Posted On

2017-03-31