Incidental Mutation 'R5973:Trpc4'
ID471520
Institutional Source Beutler Lab
Gene Symbol Trpc4
Ensembl Gene ENSMUSG00000027748
Gene Nametransient receptor potential cation channel, subfamily C, member 4
SynonymsTrrp4, STRPC4, Trp4, CCE1
MMRRC Submission 044156-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R5973 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location54156035-54318471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54315842 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 733 (E733G)
Ref Sequence ENSEMBL: ENSMUSP00000143593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]
Predicted Effect probably damaging
Transcript: ENSMUST00000029311
AA Change: E733G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: E733G

DomainStartEndE-ValueType
Blast:ANK 33 63 4e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.2e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 4.2e-33 PFAM
low complexity region 763 780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200048
AA Change: E733G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: E733G

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.1e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 3.5e-33 PFAM
low complexity region 763 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200341
SMART Domains Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 6.4e-33 PFAM
transmembrane domain 331 351 N/A INTRINSIC
transmembrane domain 366 383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,226,867 I1536N probably damaging Het
Actr1b A G 1: 36,702,081 S140P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc7 A T 5: 122,428,303 T92S probably benign Het
Ash2l G A 8: 25,817,614 T585M possibly damaging Het
Asxl1 T C 2: 153,402,011 F1495L probably damaging Het
Atp5j T C 16: 84,828,440 probably null Het
Bcl2a1c A G 9: 114,330,397 N81S probably benign Het
Bfsp2 A C 9: 103,432,657 probably null Het
Casq1 A G 1: 172,219,501 Y64H probably damaging Het
Ceacam16 A G 7: 19,856,337 V227A probably damaging Het
Cers6 T A 2: 69,068,625 probably null Het
Chrnb1 A G 11: 69,795,845 probably benign Het
Clpb G A 7: 101,663,997 V63I probably benign Het
Dnah11 G T 12: 118,110,952 D1388E probably benign Het
Dst T C 1: 34,156,857 L405P probably damaging Het
Dstyk A G 1: 132,434,411 E193G probably damaging Het
Dusp2 A T 2: 127,337,288 S188C probably damaging Het
Ep400 T C 5: 110,729,831 I810V unknown Het
Faim2 C T 15: 99,521,251 G79D probably benign Het
Fpgt A T 3: 155,087,403 I329K probably damaging Het
Fut8 A G 12: 77,364,997 T78A probably benign Het
Gm10436 T C 12: 88,175,913 I312V probably benign Het
Gm14124 A G 2: 150,267,935 T182A unknown Het
Gm15130 A G 2: 111,135,369 probably benign Het
Gm17087 A C 17: 8,566,697 I58R probably benign Het
Gm5724 T A 6: 141,754,456 T117S probably benign Het
Grk2 T C 19: 4,287,897 D485G possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hmcn1 A G 1: 150,563,817 S5539P probably damaging Het
Hmcn2 G A 2: 31,420,323 V3310M probably damaging Het
Impdh1 A T 6: 29,207,162 L61Q probably damaging Het
Inhbb A T 1: 119,418,076 V161D possibly damaging Het
Kansl2 C T 15: 98,529,425 V192M probably damaging Het
Krt2 T C 15: 101,816,312 K288E probably damaging Het
Lyar A G 5: 38,227,946 K110R probably damaging Het
Lyrm9 C A 11: 78,836,135 H35N probably damaging Het
Mab21l1 A G 3: 55,783,112 D40G probably benign Het
Maml2 A C 9: 13,621,619 probably benign Het
Mbd5 A G 2: 49,272,389 H69R probably benign Het
Morc2b G T 17: 33,137,472 A442E probably damaging Het
Moxd2 A T 6: 40,878,810 L615Q probably damaging Het
Msh2 G A 17: 87,708,583 G548S probably damaging Het
Napg G A 18: 62,994,983 S279N possibly damaging Het
Ncor1 A T 11: 62,349,310 probably null Het
Nkiras2 G T 11: 100,626,040 R128L probably damaging Het
Npy4r T C 14: 34,146,707 D208G probably benign Het
Olfr1333 C T 4: 118,830,216 V75I probably benign Het
Olfr589 A G 7: 103,154,874 V291A possibly damaging Het
Olfr901 G T 9: 38,430,331 L16F probably damaging Het
Pcdhgb2 A G 18: 37,690,507 T184A probably benign Het
Plxna4 T C 6: 32,251,065 probably null Het
Pnldc1 C T 17: 12,894,373 E328K probably benign Het
Pon1 T A 6: 5,185,334 L55F probably damaging Het
Prkci G T 3: 31,038,456 D296Y probably damaging Het
Prkd1 T C 12: 50,388,255 H563R probably damaging Het
Ptpru T C 4: 131,818,925 N266S probably benign Het
Rapgef6 A T 11: 54,639,783 I589F probably damaging Het
Rcan3 A T 4: 135,418,542 S127T probably benign Het
Sh3tc2 A G 18: 61,977,904 D277G probably benign Het
Sipa1l3 G A 7: 29,399,524 A440V probably benign Het
Slc13a2 A C 11: 78,400,532 I372S probably damaging Het
Spns1 A T 7: 126,370,323 I528N probably damaging Het
Sult6b2 T C 6: 142,790,295 K191R probably benign Het
Swt1 A G 1: 151,402,949 probably null Het
Tcn2 A T 11: 3,927,546 L34* probably null Het
Tmem131l C T 3: 83,922,246 A1035T possibly damaging Het
Uap1l1 A T 2: 25,364,630 H184Q possibly damaging Het
Vil1 T G 1: 74,416,033 V48G possibly damaging Het
Vps39 A T 2: 120,328,705 H367Q probably damaging Het
Wars2 A G 3: 99,187,646 T86A probably benign Het
Wdr90 A G 17: 25,845,133 S1872P probably damaging Het
Wdr90 A G 17: 25,846,407 L1625P probably damaging Het
Xaf1 A T 11: 72,303,430 M46L probably damaging Het
Other mutations in Trpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trpc4 APN 3 54302175 missense probably damaging 1.00
IGL01067:Trpc4 APN 3 54222562 missense probably benign 0.01
IGL01475:Trpc4 APN 3 54266407 missense possibly damaging 0.87
IGL01544:Trpc4 APN 3 54302146 missense probably damaging 0.99
IGL01688:Trpc4 APN 3 54266074 splice site probably benign
IGL02134:Trpc4 APN 3 54315654 missense possibly damaging 0.46
IGL02237:Trpc4 APN 3 54222362 missense probably damaging 1.00
IGL02301:Trpc4 APN 3 54291232 missense probably damaging 1.00
IGL02549:Trpc4 APN 3 54222349 missense possibly damaging 0.92
IGL02742:Trpc4 APN 3 54299246 missense probably damaging 1.00
IGL02815:Trpc4 APN 3 54299274 splice site probably benign
R0498:Trpc4 UTSW 3 54291211 missense probably damaging 1.00
R0555:Trpc4 UTSW 3 54302090 splice site probably benign
R0609:Trpc4 UTSW 3 54194768 missense probably damaging 1.00
R1351:Trpc4 UTSW 3 54195002 missense probably damaging 1.00
R1595:Trpc4 UTSW 3 54315815 missense probably benign 0.02
R1623:Trpc4 UTSW 3 54299179 missense probably damaging 1.00
R1763:Trpc4 UTSW 3 54194822 missense possibly damaging 0.90
R1843:Trpc4 UTSW 3 54279994 missense probably benign 0.19
R1856:Trpc4 UTSW 3 54279989 missense probably damaging 1.00
R1936:Trpc4 UTSW 3 54279890 missense probably damaging 1.00
R2196:Trpc4 UTSW 3 54302193 missense probably benign 0.03
R2441:Trpc4 UTSW 3 54222283 missense probably damaging 0.96
R2877:Trpc4 UTSW 3 54291340 missense probably damaging 1.00
R3846:Trpc4 UTSW 3 54318012 missense probably benign 0.22
R3931:Trpc4 UTSW 3 54318095 missense probably damaging 1.00
R4854:Trpc4 UTSW 3 54302218 missense probably damaging 1.00
R5024:Trpc4 UTSW 3 54194796 missense probably benign 0.11
R5284:Trpc4 UTSW 3 54279947 missense probably damaging 0.99
R5320:Trpc4 UTSW 3 54299178 missense probably damaging 0.99
R6276:Trpc4 UTSW 3 54318020 missense probably benign 0.25
R6335:Trpc4 UTSW 3 54317574 critical splice donor site probably null
R7082:Trpc4 UTSW 3 54299098 nonsense probably null
X0066:Trpc4 UTSW 3 54194750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGTGCTGCTGATAACTTG -3'
(R):5'- AAGGATGTTTCAAAGCAACTTGGG -3'

Sequencing Primer
(F):5'- GCTGCTGATAACTTGAGAAGACATC -3'
(R):5'- CAAAGCAACTTGGGAAATTTCTC -3'
Posted On2017-03-31