Incidental Mutation 'R0501:Cacna1h'
ID47163
Institutional Source Beutler Lab
Gene Symbol Cacna1h
Ensembl Gene ENSMUSG00000024112
Gene Namecalcium channel, voltage-dependent, T type, alpha 1H subunit
SynonymsCav3.2, alpha13.2, T-type Cav3.2
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25374285-25433783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25388667 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 892 (V892E)
Ref Sequence ENSEMBL: ENSMUSP00000125541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610]
Predicted Effect probably damaging
Transcript: ENSMUST00000078496
AA Change: V892E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112
AA Change: V892E

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 138 418 8.4e-65 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 824 1011 4.7e-46 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1341 1565 4.5e-56 PFAM
low complexity region 1576 1602 N/A INTRINSIC
Pfam:Ion_trans 1656 1864 7.8e-48 PFAM
Pfam:PKD_channel 1714 1871 1.2e-10 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159048
AA Change: V786E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112
AA Change: V786E

DomainStartEndE-ValueType
Pfam:Ion_trans 32 312 8e-65 PFAM
low complexity region 394 405 N/A INTRINSIC
low complexity region 409 425 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Pfam:Ion_trans 718 905 4.6e-46 PFAM
low complexity region 1024 1041 N/A INTRINSIC
low complexity region 1142 1153 N/A INTRINSIC
Pfam:Ion_trans 1235 1459 4.3e-56 PFAM
low complexity region 1470 1496 N/A INTRINSIC
Pfam:PKD_channel 1524 1608 1.6e-6 PFAM
Pfam:Ion_trans 1550 1758 7.6e-48 PFAM
Pfam:PKD_channel 1609 1765 1.2e-10 PFAM
Blast:Tryp_SPc 1809 1854 9e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159610
AA Change: V892E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112
AA Change: V892E

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 99 430 7e-79 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 789 1023 2.4e-58 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1304 1577 4.5e-65 PFAM
Pfam:Ion_trans 1621 1876 4.2e-59 PFAM
Pfam:PKD_channel 1629 1715 9.3e-7 PFAM
Pfam:PKD_channel 1713 1871 2.2e-11 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162820
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nid2 T A 14: 19,789,668 probably null Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Cacna1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cacna1h APN 17 25381508 missense probably damaging 1.00
IGL01412:Cacna1h APN 17 25391950 missense probably benign 0.24
IGL01625:Cacna1h APN 17 25383485 missense probably damaging 0.97
IGL01625:Cacna1h APN 17 25385712 missense possibly damaging 0.95
IGL01684:Cacna1h APN 17 25388716 missense probably damaging 1.00
IGL01862:Cacna1h APN 17 25383483 missense probably damaging 1.00
IGL01877:Cacna1h APN 17 25388050 missense probably damaging 1.00
IGL02040:Cacna1h APN 17 25397611 missense probably benign 0.10
IGL02190:Cacna1h APN 17 25433026 missense probably benign
IGL02686:Cacna1h APN 17 25385749 missense possibly damaging 0.80
IGL02883:Cacna1h APN 17 25380532 missense probably damaging 1.00
IGL02945:Cacna1h APN 17 25388059 missense probably damaging 1.00
IGL03025:Cacna1h APN 17 25432894 nonsense probably null
IGL03095:Cacna1h APN 17 25383778 unclassified probably benign
IGL03207:Cacna1h APN 17 25391333 missense probably damaging 1.00
IGL02991:Cacna1h UTSW 17 25391312 missense possibly damaging 0.56
IGL03097:Cacna1h UTSW 17 25391144 missense probably damaging 1.00
R0010:Cacna1h UTSW 17 25380844 missense probably damaging 1.00
R0194:Cacna1h UTSW 17 25380924 unclassified probably benign
R0361:Cacna1h UTSW 17 25389422 missense probably damaging 1.00
R0558:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R0588:Cacna1h UTSW 17 25387564 missense probably damaging 1.00
R0626:Cacna1h UTSW 17 25393546 missense possibly damaging 0.92
R0811:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0812:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0964:Cacna1h UTSW 17 25378775 unclassified probably benign
R1351:Cacna1h UTSW 17 25391951 missense probably benign 0.14
R1457:Cacna1h UTSW 17 25397620 missense probably damaging 1.00
R1521:Cacna1h UTSW 17 25397354 missense possibly damaging 0.57
R1564:Cacna1h UTSW 17 25377861 nonsense probably null
R1611:Cacna1h UTSW 17 25381471 missense probably damaging 1.00
R1669:Cacna1h UTSW 17 25383471 missense probably damaging 1.00
R1835:Cacna1h UTSW 17 25392076 missense probably benign 0.01
R1858:Cacna1h UTSW 17 25380807 missense probably damaging 1.00
R1887:Cacna1h UTSW 17 25376887 missense probably benign 0.01
R2039:Cacna1h UTSW 17 25391845 missense probably benign 0.03
R2091:Cacna1h UTSW 17 25432876 missense possibly damaging 0.95
R2133:Cacna1h UTSW 17 25383528 missense probably damaging 1.00
R2203:Cacna1h UTSW 17 25380260 missense probably damaging 1.00
R2205:Cacna1h UTSW 17 25380260 missense probably damaging 1.00
R2206:Cacna1h UTSW 17 25385013 missense probably benign 0.10
R2207:Cacna1h UTSW 17 25385013 missense probably benign 0.10
R2224:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2226:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2261:Cacna1h UTSW 17 25433165 missense possibly damaging 0.91
R2361:Cacna1h UTSW 17 25384012 missense probably damaging 1.00
R2917:Cacna1h UTSW 17 25395452 missense probably damaging 0.97
R3031:Cacna1h UTSW 17 25433134 missense probably damaging 0.99
R3856:Cacna1h UTSW 17 25392453 missense probably damaging 1.00
R4230:Cacna1h UTSW 17 25387863 missense probably damaging 1.00
R4408:Cacna1h UTSW 17 25380627 missense probably damaging 1.00
R4687:Cacna1h UTSW 17 25393910 missense possibly damaging 0.47
R4887:Cacna1h UTSW 17 25377287 missense possibly damaging 0.86
R4895:Cacna1h UTSW 17 25389422 missense probably damaging 0.99
R5067:Cacna1h UTSW 17 25397808 missense probably damaging 1.00
R5077:Cacna1h UTSW 17 25375250 missense probably benign 0.02
R5148:Cacna1h UTSW 17 25387545 missense probably damaging 1.00
R5336:Cacna1h UTSW 17 25392231 missense probably damaging 0.99
R5450:Cacna1h UTSW 17 25383186 missense probably damaging 1.00
R5616:Cacna1h UTSW 17 25377667 missense probably damaging 1.00
R5738:Cacna1h UTSW 17 25387049 missense probably damaging 0.99
R5883:Cacna1h UTSW 17 25376922 missense probably benign 0.00
R5954:Cacna1h UTSW 17 25383201 missense probably damaging 1.00
R5961:Cacna1h UTSW 17 25377272 missense probably benign 0.01
R6110:Cacna1h UTSW 17 25391276 missense probably benign 0.10
R6125:Cacna1h UTSW 17 25385694 missense probably benign 0.00
R6189:Cacna1h UTSW 17 25397844 missense probably damaging 1.00
R6216:Cacna1h UTSW 17 25378819 missense probably damaging 1.00
R6259:Cacna1h UTSW 17 25397656 critical splice acceptor site probably null
R6296:Cacna1h UTSW 17 25383079 missense probably damaging 1.00
R6394:Cacna1h UTSW 17 25387481 missense probably benign 0.32
R6695:Cacna1h UTSW 17 25393740 missense probably damaging 1.00
R6746:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R6914:Cacna1h UTSW 17 25385039 missense probably benign
R6942:Cacna1h UTSW 17 25385039 missense probably benign
R6955:Cacna1h UTSW 17 25388056 missense probably damaging 1.00
R7041:Cacna1h UTSW 17 25394003 missense probably damaging 0.98
R7120:Cacna1h UTSW 17 25391507 missense probably benign 0.31
R7125:Cacna1h UTSW 17 25383536 missense probably damaging 0.99
R7182:Cacna1h UTSW 17 25377655 missense probably damaging 1.00
R7270:Cacna1h UTSW 17 25384765 missense probably damaging 1.00
R7274:Cacna1h UTSW 17 25378837 missense probably damaging 1.00
R7319:Cacna1h UTSW 17 25389461 missense possibly damaging 0.94
V1662:Cacna1h UTSW 17 25377309 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACACCCTCCCTAAGTGTCAAGACTG -3'
(R):5'- AGCTGATGGGGCTACTTGCTGAAC -3'

Sequencing Primer
(F):5'- CTATGCATCTGTGGGCCTCAG -3'
(R):5'- CCCAGCTATGGTGTTGAACAG -3'
Posted On2013-06-12