Incidental Mutation 'R5974:Galr2'
ID471632
Institutional Source Beutler Lab
Gene Symbol Galr2
Ensembl Gene ENSMUSG00000020793
Gene Namegalanin receptor 2
SynonymsmGalR, GalR2
MMRRC Submission 044157-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5974 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116280939-116283938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116283026 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 161 (S161G)
Ref Sequence ENSEMBL: ENSMUSP00000054062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021147] [ENSMUST00000055872] [ENSMUST00000106411] [ENSMUST00000106413]
Predicted Effect probably benign
Transcript: ENSMUST00000021147
SMART Domains Protein: ENSMUSP00000021147
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 310 691 6.9e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000055872
AA Change: S161G

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054062
Gene: ENSMUSG00000020793
AA Change: S161G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 306 4.1e-12 PFAM
Pfam:7tm_1 41 291 6.4e-52 PFAM
Pfam:7TM_GPCR_Srv 62 307 1.2e-7 PFAM
Pfam:7TM_GPCR_Srw 184 308 4.7e-8 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106411
SMART Domains Protein: ENSMUSP00000102019
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 278 648 4e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106413
SMART Domains Protein: ENSMUSP00000102021
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 309 679 6.4e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154277
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Galanin is an important neuromodulator present in the brain, gastrointestinal system, and hypothalamopituitary axis. It is a 30-amino acid non-C-terminally amidated peptide that potently stimulates growth hormone secretion, inhibits cardiac vagal slowing of heart rate, abolishes sinus arrhythmia, and inhibits postprandial gastrointestinal motility. The actions of galanin are mediated through interaction with specific membrane receptors that are members of the 7-transmembrane family of G protein-coupled receptors. GALR2 interacts with the N-terminal residues of the galanin peptide. The primary signaling mechanism for GALR2 is through the phospholipase C/protein kinase C pathway (via Gq), in contrast to GALR1, which communicates its intracellular signal by inhibition of adenylyl cyclase through Gi. However, it has been demonstrated that GALR2 couples efficiently to both the Gq and Gi proteins to simultaneously activate 2 independent signal transduction pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a reduction in exploratory activity. There is also a modest shift in the distribution of different lymphocyte cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc4 T C 5: 52,845,400 L261P probably damaging Het
Aqp6 A G 15: 99,601,436 Y10C probably benign Het
Ccnb1ip1 A T 14: 50,792,205 N133K probably benign Het
Clip4 A T 17: 71,831,247 H433L probably damaging Het
Cntnap5c T A 17: 57,876,485 M62K probably benign Het
Col12a1 A G 9: 79,682,127 S1049P probably damaging Het
Col15a1 C T 4: 47,258,683 T358I probably benign Het
Coro7 A T 16: 4,631,889 D645E possibly damaging Het
Ctnnal1 C A 4: 56,817,067 W585L probably damaging Het
Ctnnd1 C A 2: 84,620,915 E114* probably null Het
Daam2 T A 17: 49,464,473 S882C probably damaging Het
Des T A 1: 75,362,984 S329T probably benign Het
Dido1 T C 2: 180,671,497 D994G probably benign Het
Dock3 A G 9: 106,994,062 V547A probably damaging Het
Ebf4 G A 2: 130,365,564 A643T probably damaging Het
Ect2 C A 3: 27,144,963 E194* probably null Het
Epb41l2 A G 10: 25,441,815 I77V possibly damaging Het
Fat3 A T 9: 16,006,528 probably null Het
Fbn2 T G 18: 58,048,920 D1803A probably damaging Het
Fbxo10 T C 4: 45,040,631 E858G probably benign Het
Fbxo24 C T 5: 137,619,650 R284Q probably benign Het
Fsip2 T A 2: 82,963,313 I425N possibly damaging Het
Fut9 A C 4: 25,620,090 Y241* probably null Het
Gcc2 T A 10: 58,258,243 L14I probably damaging Het
Gm11127 A T 17: 36,056,785 D220E probably benign Het
Hdac11 G A 6: 91,173,214 V332I probably benign Het
Hdac7 T C 15: 97,802,072 probably null Het
Kif16b C T 2: 142,857,381 G93D probably damaging Het
Krtap11-1 C A 16: 89,570,768 C121F possibly damaging Het
Lacc1 T C 14: 77,035,077 Q93R probably damaging Het
Lama1 T C 17: 67,773,727 F1250S probably benign Het
Lmbrd2 A G 15: 9,172,115 E332G probably benign Het
Lrp2 C A 2: 69,459,548 C3649F probably damaging Het
Map1a T C 2: 121,304,376 V1653A probably benign Het
Mrpl1 T C 5: 96,231,794 probably null Het
Myo1b A G 1: 51,778,373 S577P probably damaging Het
Nedd4 T A 9: 72,743,638 probably null Het
Negr1 T A 3: 157,069,286 V213E probably damaging Het
Nlk T G 11: 78,590,966 Q223P probably benign Het
Ntn5 A G 7: 45,691,424 H162R probably damaging Het
Nupl2 T C 5: 24,167,402 S63P probably damaging Het
Obscn C A 11: 59,076,547 D477Y probably damaging Het
Olfr101 A T 17: 37,300,338 I28N possibly damaging Het
Olfr1037 T C 2: 86,084,881 S299G probably benign Het
Olfr1434 T C 19: 12,283,836 S263P probably damaging Het
Pabpn1 A G 14: 54,897,160 T280A probably damaging Het
Per3 A T 4: 151,042,737 V109E possibly damaging Het
Pira2 A C 7: 3,841,577 V485G probably benign Het
Pknox2 A G 9: 36,936,322 L133P probably damaging Het
Pros1 A C 16: 62,900,667 N195T probably damaging Het
Rffl T C 11: 82,806,151 K289E probably damaging Het
Ripk1 T A 13: 34,030,101 Y475* probably null Het
Ryr2 A G 13: 11,714,511 probably null Het
Sgk1 T A 10: 21,996,249 N241K probably damaging Het
Skint1 T A 4: 112,019,319 S146T probably benign Het
Sox30 G T 11: 45,981,073 D252Y probably damaging Het
Syngap1 A G 17: 26,963,038 Y1002C probably damaging Het
Tiam2 A G 17: 3,414,809 D271G possibly damaging Het
Ticam1 T C 17: 56,271,178 T306A probably benign Het
Tmem252 A G 19: 24,674,268 E67G probably benign Het
Tnxb T G 17: 34,685,707 F1149V probably damaging Het
Ubr4 A G 4: 139,421,078 probably null Het
Unc50 A G 1: 37,437,209 D150G probably benign Het
Ywhag A C 5: 135,911,629 L37R probably damaging Het
Zfp296 T C 7: 19,577,937 L123P probably benign Het
Zfp418 G T 7: 7,182,200 Q387H possibly damaging Het
Zfp882 T C 8: 71,913,155 F53L probably damaging Het
Other mutations in Galr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Galr2 APN 11 116283170 missense probably damaging 1.00
PIT4418001:Galr2 UTSW 11 116283258 missense probably benign 0.35
PIT4445001:Galr2 UTSW 11 116281648 missense probably benign 0.13
R0426:Galr2 UTSW 11 116281691 missense probably damaging 1.00
R1869:Galr2 UTSW 11 116283243 missense possibly damaging 0.87
R2059:Galr2 UTSW 11 116282939 missense probably damaging 1.00
R4579:Galr2 UTSW 11 116281499 missense probably benign
R4666:Galr2 UTSW 11 116283629 missense probably benign
R5832:Galr2 UTSW 11 116281631 missense probably damaging 1.00
R7081:Galr2 UTSW 11 116283048 missense probably damaging 0.99
R7155:Galr2 UTSW 11 116283582 missense possibly damaging 0.94
X0009:Galr2 UTSW 11 116283323 missense probably benign 0.14
X0026:Galr2 UTSW 11 116281751 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCAGTGGCCACATTCTCAG -3'
(R):5'- AGCTACTGGGTCAACTGTGC -3'

Sequencing Primer
(F):5'- GGTCTAGCAGTGAATTAGTGAATCC -3'
(R):5'- TCAACTGTGCGCCAGAGGTAG -3'
Posted On2017-03-31